Dataset for CDS BIK of organism Piliocolobus tephrosceles

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9HKG2_BIK-03      atgtctggagtaagacccatctccaga------------------gacat
A0A8C9HKG2_BIK-01      atgcc---attcagaccccagtccaggattccgcgctcggggtgcgagag
A0A8C9HKG2_BIK-02      atgcc---attcagaccccagtccaggattccgcgctcggggtgcgagag
                       *** *   * * ******   *****                   ** * 

A0A8C9HKG2_BIK-03      attgat-----------------ggagaccctcctgtatgagcagctcct
A0A8C9HKG2_BIK-01      gctgctcccggggcggggcggggagggacccgggcggggagggaggggcg
A0A8C9HKG2_BIK-02      gctgctcccggggcggggcggggagggacccgggcggggagggaggggcg
                         ** *                  * *****    *     * **   * 

A0A8C9HKG2_BIK-03      ggaacccctaaccatggaggttcttggtgtgactgaccctgaagaggacc
A0A8C9HKG2_BIK-01      gggcgcccggacctattaggtccc--gcgccggcagccgggcagtagaca
A0A8C9HKG2_BIK-02      gggcgcccggacctattaggtccc--gcgccggcagccgggcagtagaca
                       **   ***  ***    **** *   * *       **  * **  *** 

A0A8C9HKG2_BIK-03      tggacc--ctatggaggacttcgatcctttggagtgt-atggaggacagt
A0A8C9HKG2_BIK-01      cgaagcttctccggtggctcacagacgctgccagcatcgccgccgccagt
A0A8C9HKG2_BIK-02      cgaagcttctccggtggctcacagacgctgccagcatcgccgccgccagt
                        * * *  **  ** **    *   *  *   **  *    *  * ****

A0A8C9HKG2_BIK-03      gacatgttggccctgcagctggcctgcatcggggatgagatggacgtgag
A0A8C9HKG2_BIK-01      gacatgttggccctgcagctggcctgcatcggggatgagatggacgtgag
A0A8C9HKG2_BIK-02      gacatgttggccctgcagctggcctgcatcggggatgagatggacgtgag
                       **************************************************

A0A8C9HKG2_BIK-03      cctcagggccccgcgcctggcccagctctctgaggtggccatgcacagcc
A0A8C9HKG2_BIK-01      cctcagggccccgcgcctggcccagctctctgaggtggccatgcacagcc
A0A8C9HKG2_BIK-02      cctcagggccccgcgcctggcccagctctctgaggtggccatgcacagcc
                       **************************************************

A0A8C9HKG2_BIK-03      tgggtctggctttcatctacgaccagaccgacgacatcagggatgttctt
A0A8C9HKG2_BIK-01      tgggtctggctttcatctacgaccagaccgacgacatcagggatgttctt
A0A8C9HKG2_BIK-02      tgggtctggctttcatctacgaccagaccgacgacatcagggatgttctt
                       **************************************************

A0A8C9HKG2_BIK-03      agaagtttcatggacggcttcaccacccttaaggagaacataatgaggtt
A0A8C9HKG2_BIK-01      agaagtttcatggacggcttcaccacccttaaggagaacataatgaggtt
A0A8C9HKG2_BIK-02      agaagtttcatggacggcttcaccacccttaaggagaacataatgaggtt
                       **************************************************

A0A8C9HKG2_BIK-03      ctggagatccccgaatcccgggtcccgggt--------------------
A0A8C9HKG2_BIK-01      ctggagatccccgaatcccgggtcccgggt--------------------
A0A8C9HKG2_BIK-02      ctggagatccccgaatcccgggtcccgggtaagagccttcagattcctga
                       ******************************                    

A0A8C9HKG2_BIK-03      ---------gtcccgcgaaca---ggtgctgctggcgctgct--------
A0A8C9HKG2_BIK-01      ---------gtcccgcgaaca---ggtgctgctggcgctgct--------
A0A8C9HKG2_BIK-02      ccctgactggctctgcggccagtgggggctgtcagagctgctcctcaggg
                                *  * ***  **   ** ****   * ******        

A0A8C9HKG2_BIK-03      --------------------------------------------------
A0A8C9HKG2_BIK-01      --------------------------------------------------
A0A8C9HKG2_BIK-02      cgccacagtccccatcactccctgtcatctgctgtgtcatcgttgtccac
                                                                         

A0A8C9HKG2_BIK-03      ------------------gctgttg-------------------------
A0A8C9HKG2_BIK-01      ------------------gctgttg-------------------------
A0A8C9HKG2_BIK-02      atctgcctggtcccataggcttttgagtttgggattcctggttatgagtg
                                         *** ***                         

A0A8C9HKG2_BIK-03      -------------------ctggcactgctgctggc--------------
A0A8C9HKG2_BIK-01      -------------------ctggcactgctgctggc--------------
A0A8C9HKG2_BIK-02      cacaaaccagtgcgtggtcctgggtctccctctggcccgagagccttcac
                                          ****  ** *  *****              

A0A8C9HKG2_BIK-03      -------------------gctgctcagcgggg-----------------
A0A8C9HKG2_BIK-01      -------------------gctgctcagcgggg-----------------
A0A8C9HKG2_BIK-02      ctggcagacaggattctcgtctcctcgccagggcagaggccccctgagca
                                           ** ***  * ***                 

A0A8C9HKG2_BIK-03      --------------------------------------------------
A0A8C9HKG2_BIK-01      --------------------------------------------------
A0A8C9HKG2_BIK-02      gccttcctggcagcctggtcccattctgcactgcccaccaccagggcagc
                                                                         

A0A8C9HKG2_BIK-03      -----gcctgcacctgc---------------------------------
A0A8C9HKG2_BIK-01      -----gcctgcacctgc---------------------------------
A0A8C9HKG2_BIK-02      tgatcgccctcacctgtgtccaccctttgcctgtgtcccacagactggca
                            ***  ******                                  

A0A8C9HKG2_BIK-03      ----------------------tgctcaag------------------tg
A0A8C9HKG2_BIK-01      ----------------------tgctcaag------------------tg
A0A8C9HKG2_BIK-02      gccgctggcctctttggccatgtcctcagggccactttccccctctcctg
                                             * **** *                  **

A0A8C9HKG2_BIK-03      a
A0A8C9HKG2_BIK-01      a
A0A8C9HKG2_BIK-02      a
                       *

© 1998-2022Legal notice