Dataset for CDS BIK of organism Peromyscus maniculatus bairdii

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A6I9LKH4_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BIK (length=480 residues).
atgtcggaggcaagactcatggccagagacctcatcaagactgtcttgcatgaccaggtcccccgacctccagtggctcc
tggggctcccagcatgaaggagcccgtggaggaagaaaatattagtcctgtgagagacctggaccttgcggagtgcctgg
aggacagaaaccaggtggccctgaggctggcctacatcggtgatgagatggacctgtgtctgcggagcccccgtctggcc
cagctgcccgggattgccatgcacagactcgctgtcacctacagccagacgggggtcaggggcgttttcaggagcctgat
tcgtggcctcaccaacctcagggaaaacatttggtcctggagagtcccgactcctggcacctgggtgttacctgaccagg
cccgaggacagctgtttcccatggtgctgttggttctcttgctgctgggcggcgaggccctgcgtttgcagcttcagtga
>gnl|bcl2dbcds|A0A8C8U1G0_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BIK (length=456 residues).
atgtcggaggcaagactcatggccagagacctcatcaagactgtcttgcatgaccaggtcccccgacctccagtggctcc
tggggctcccagcatgaaggagcctgtgagagacctggaccttgcggagtgcctggaggacagaaaccaggtggccctga
ggctggcctacatcggtgatgagatggacctgtgtctgcggagcccccgtctggcccagctgcccgggattgccatgcac
agactcgctgtcacctacagccagacgggggtcaggggcgttttcaggagcctgattcgtggcctcaccaacctcaggga
aaacatttggtcctggagagtcccgactcctggcacctgggtgttacctgaccaggcccgaggacagctgtttcccatgg
tgctgttggttctcttgctgctgggcggcgaggccctgcgtttgcagcttcagtga
© 1998-2022Legal notice