Dataset for CDS BIK of organism Peromyscus maniculatus bairdii

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A6I9LKH4_BIK-01      atgtcggaggcaagactcatggccagagacctcatcaagactgtcttgca
A0A8C8U1G0_BIK-01      atgtcggaggcaagactcatggccagagacctcatcaagactgtcttgca
                       **************************************************

A0A6I9LKH4_BIK-01      tgaccaggtcccccgacctccagtggctcctggggctcccagcatgaagg
A0A8C8U1G0_BIK-01      tgaccaggtcccccgacctccagtggctcctggggctcccagcatgaagg
                       **************************************************

A0A6I9LKH4_BIK-01      agcccgtggaggaagaaaatattagtcctgtgagagacctggaccttgcg
A0A8C8U1G0_BIK-01      ag------------------------cctgtgagagacctggaccttgcg
                       **                        ************************

A0A6I9LKH4_BIK-01      gagtgcctggaggacagaaaccaggtggccctgaggctggcctacatcgg
A0A8C8U1G0_BIK-01      gagtgcctggaggacagaaaccaggtggccctgaggctggcctacatcgg
                       **************************************************

A0A6I9LKH4_BIK-01      tgatgagatggacctgtgtctgcggagcccccgtctggcccagctgcccg
A0A8C8U1G0_BIK-01      tgatgagatggacctgtgtctgcggagcccccgtctggcccagctgcccg
                       **************************************************

A0A6I9LKH4_BIK-01      ggattgccatgcacagactcgctgtcacctacagccagacgggggtcagg
A0A8C8U1G0_BIK-01      ggattgccatgcacagactcgctgtcacctacagccagacgggggtcagg
                       **************************************************

A0A6I9LKH4_BIK-01      ggcgttttcaggagcctgattcgtggcctcaccaacctcagggaaaacat
A0A8C8U1G0_BIK-01      ggcgttttcaggagcctgattcgtggcctcaccaacctcagggaaaacat
                       **************************************************

A0A6I9LKH4_BIK-01      ttggtcctggagagtcccgactcctggcacctgggtgttacctgaccagg
A0A8C8U1G0_BIK-01      ttggtcctggagagtcccgactcctggcacctgggtgttacctgaccagg
                       **************************************************

A0A6I9LKH4_BIK-01      cccgaggacagctgtttcccatggtgctgttggttctcttgctgctgggc
A0A8C8U1G0_BIK-01      cccgaggacagctgtttcccatggtgctgttggttctcttgctgctgggc
                       **************************************************

A0A6I9LKH4_BIK-01      ggcgaggccctgcgtttgcagcttcagtga
A0A8C8U1G0_BIK-01      ggcgaggccctgcgtttgcagcttcagtga
                       ******************************

© 1998-2022Legal notice