Dataset for CDS BCL2L11 of organism Peromyscus maniculatus bairdii

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A6I9LW27_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BCL2L11 (length=582 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gcttaggcctggggcccctacctccctacagacagaaccgcaaggtaatcccgacggaggcggcgaaggggaccgctgcc
cccacggcagccctcagggcccgctggccccaccggccagccctgggccttttgctaccagatccccacttttcatcttt
gtgagaagatcttctctgctgtcccggtcctccagtgggtatttctcttttgacacagacaggagtccggcacccatgag
ttgtgacaagtcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcgatggcttccataaggc
agtctcaggaggaacctgcagacgttcgccctgagatacggattgcacaggaacttcggcggattggagacgagttcaat
gagtcctacacgaggagggctgaagaccaccctcaccaccctcaaatggttatcttacaactgttacgtttcttcatccg
tctagtatggagaaggcattga
>gnl|bcl2dbcds|A0A6I9LW27_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BCL2L11 (length=408 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gcttaggcctggggcccctacctccctacagacagaaccgcaagacaggagtccggcacccatgagttgtgacaagtcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcgatggcttccataaggcagtctcaggaggaa
cctgcagacgttcgccctgagatacggattgcacaggaacttcggcggattggagacgagttcaatgagtcctacacgag
gagggctgaagaccaccctcaccaccctcaaatggttatcttacaactgttacgtttcttcatccgtctagtatggagaa
ggcattga
>gnl|bcl2dbcds|A0A6I9LW27_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BCL2L11 (length=273 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gcttaggcctggggcccctacctccctacagacagaaccgcaagacaggagtccggcacccatgagttgtgacaagtcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcgatggatctttgtgagactcttaaaccaaga
gaacaaattcatggtgatgcacaaaaaaactgg
© 1998-2022Legal notice