Dataset for CDS BCL2L11 of organism Peromyscus maniculatus bairdii

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A6I9LW27_BCL2L11      atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtgg
A0A6I9LW27_BCL2L11      atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtgg
A0A6I9LW27_BCL2L11      atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtgg
                        **************************************************

A0A6I9LW27_BCL2L11      acaattgcagcctgctgagaggcctccccagcttaggcctggggccccta
A0A6I9LW27_BCL2L11      acaattgcagcctgctgagaggcctccccagcttaggcctggggccccta
A0A6I9LW27_BCL2L11      acaattgcagcctgctgagaggcctccccagcttaggcctggggccccta
                        **************************************************

A0A6I9LW27_BCL2L11      cctccctacagacagaaccgca----------------------------
A0A6I9LW27_BCL2L11      cctccctacagacagaaccgcaaggtaatcccgacggaggcggcgaaggg
A0A6I9LW27_BCL2L11      cctccctacagacagaaccgca----------------------------
                        **********************                            

A0A6I9LW27_BCL2L11      --------------------------------------------------
A0A6I9LW27_BCL2L11      gaccgctgcccccacggcagccctcagggcccgctggccccaccggccag
A0A6I9LW27_BCL2L11      --------------------------------------------------
                                                                          

A0A6I9LW27_BCL2L11      --------------------------------------------------
A0A6I9LW27_BCL2L11      ccctgggccttttgctaccagatccccacttttcatctttgtgagaagat
A0A6I9LW27_BCL2L11      --------------------------------------------------
                                                                          

A0A6I9LW27_BCL2L11      ----------------------------------------------agac
A0A6I9LW27_BCL2L11      cttctctgctgtcccggtcctccagtgggtatttctcttttgacacagac
A0A6I9LW27_BCL2L11      ----------------------------------------------agac
                                                                      ****

A0A6I9LW27_BCL2L11      aggagtccggcacccatgagttgtgacaagtcaacacaaaccccaagtcc
A0A6I9LW27_BCL2L11      aggagtccggcacccatgagttgtgacaagtcaacacaaaccccaagtcc
A0A6I9LW27_BCL2L11      aggagtccggcacccatgagttgtgacaagtcaacacaaaccccaagtcc
                        **************************************************

A0A6I9LW27_BCL2L11      tccttgccaggccttcaaccattatctcagtgcgatggat----------
A0A6I9LW27_BCL2L11      tccttgccaggccttcaaccattatctcagtgcgatggcttccataaggc
A0A6I9LW27_BCL2L11      tccttgccaggccttcaaccattatctcagtgcgatggcttccataaggc
                        ************************************** *          

A0A6I9LW27_BCL2L11      ----------------------------ctttgtgagac-----------
A0A6I9LW27_BCL2L11      agtctcaggaggaacctgcagacgttcgccctgagatacggattgcacag
A0A6I9LW27_BCL2L11      agtctcaggaggaacctgcagacgttcgccctgagatacggattgcacag
                                                    *  ** ** **           

A0A6I9LW27_BCL2L11      ---------------------------------tcttaaaccaagagaac
A0A6I9LW27_BCL2L11      gaacttcggcggattggagacgagttcaatgagtcctacacgaggagggc
A0A6I9LW27_BCL2L11      gaacttcggcggattggagacgagttcaatgagtcctacacgaggagggc
                                                         ** ** ** * ***  *

A0A6I9LW27_BCL2L11      aaa-----------------ttc--atggtgat-----------------
A0A6I9LW27_BCL2L11      tgaagaccaccctcaccaccctcaaatggttatcttacaactgttacgtt
A0A6I9LW27_BCL2L11      tgaagaccaccctcaccaccctcaaatggttatcttacaactgttacgtt
                          *                  **  ***** **                 

A0A6I9LW27_BCL2L11      --------------gcacaaaaaa---actgg
A0A6I9LW27_BCL2L11      tcttcatccgtctagtatggagaaggcattga
A0A6I9LW27_BCL2L11      tcttcatccgtctagtatggagaaggcattga
                                      * *   * **   * ** 

© 1998-2022Legal notice