Dataset for CDS classical BH3-containing proteins of organism Pelusios castaneus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C8R9Q6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pelusios castaneus GN=BAD (length=564 residues).
agttcccggtcgaggtgttcccggggcaagaaaaagagtcgcctgtcccctcagagccgcggggggggggacgcgcccgg
cttcaagcagccaggcacgcccacagctggtgagaccccccccctccgattgggtggggcaggagtccagccccccccca
cacccccgagggtgggtcaatccatgatctccaaaccctccatttccttctcttcacagagctgcgaagccgaattgggt
cggaccccgcatctctggagccagaagctcaggatgagccaggtggggcattcttccggggccgctcccactcagccccc
ccccatcctatgggctgctatgcgttatgggcgggaactgcgcaggatgagtgacgagtttgacgtggctctacaggtgc
tgccacgccccaggagtgcaggcacagcatcacagctgcaccgggggagcagctggaaggagactatccaggcctggttg
gggcacaagcctgcccgtgatgtcccccgaaaagccccaagtgactgcagcccccctgcggtggagatgggaccagcccc
ttga
>gnl|bcl2dbcds|A0A8C8RL12_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Pelusios castaneus GN=BMF (length=582 residues).
atggatccccccagctacctggaggaggattattccagcctggacgggctggatgatgacgtgtttcactctgatgactt
tggactcacaggtcagcctggtgagatgacccctactggcattttcacacagaaccaatcctacagctgcctcctgggga
ggtttcaactgttcccactcacacactgctgtggtccaggtatcagacatgctgagcagcaggacaaggcaacccaaaca
ctcagcccatcctcttccactcaggatgtcatgttgccttgtggagtcactgaagagccccagagactcttctatgggaa
tgctgggtaccgtttacatgccccgccagttggctttgcattgaatccacacctccaagaggagcctcaggaaggacaac
gggaagcacatgcggaggttcagattgcacggaagttacagtgcattgcagaccagttccacaggctccacatacagagg
catcagcagaatagaaatcaagtgtggtggcagatacttctcttcctacataacttggccttaaatgtggaggcaaacag
gaaccatgcaggtcagaggtga
>gnl|bcl2dbcds|A0A8C8SQS1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Pelusios castaneus GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttctgatctaaattcagagtgcgacagagaagggggacaatttcaatcagttgaaaggccaagtca
gcctcagcatcttagacctggggcccctacctctatacaaacacagtatcaagattccaggtgccagtctgcctcaatac
atgaagacatgcagccagaaatatggattgcacaggaattgcggcgtattggagatgagtttaatgcctcctattgccca
agaagggcatcaattgctttcttcgtcttccctgctttggagctgcagagaggaaatgccctggattgggacagtcccat
cacgtcaagcgagttctaa
© 1998-2022Legal notice