Dataset for CDS classical BH3-containing proteins of organism Pelusios castaneus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C8R9Q6_BAD-01       agttcccggtcgaggtgttcccggggcaagaaaaagagtcgcctgtcccc
A0A8C8RL12_BMF-01       ------------atggatccccccagctacctggaggaggattattccag
A0A8C8SQS1_BCL2L11      ------------atgg-----caaagcaacct------------------
                                    * *      *   ** *                     

A0A8C8R9Q6_BAD-01       tcagagccgcggggggggggacgcgcccggcttcaagcagccaggcacgc
A0A8C8RL12_BMF-01       cctggacgggctggatgatgacgtgtttcactctgatgactttgg---ac
A0A8C8SQS1_BCL2L11      -------------------------------tctga----tctaa---at
                                                       *   *              

A0A8C8R9Q6_BAD-01       ccacag------ctggtgagaccccccccctccgattgggtggggcagga
A0A8C8RL12_BMF-01       tcacaggtcagcctggtgagatgacccctactggcat---tttcacacag
A0A8C8SQS1_BCL2L11      tcagagtgcg----------------------------------acagag
                         ** **                                       **   

A0A8C8R9Q6_BAD-01       gtccagcccccccccacacccccgagggtgggtcaatccatgatctccaa
A0A8C8RL12_BMF-01       aaccaatcctacagctgcctcctgggga-ggtttcaactgttcccactca
A0A8C8SQS1_BCL2L11      aa--------------------gggggacaatttcaatca----------
                                               * **     *  *              

A0A8C8R9Q6_BAD-01       accctccatttccttctcttcacaga---gctgcg----aagccgaattg
A0A8C8RL12_BMF-01       cacactgctgtggtccaggtatcagacatgctgagcagcaggacaa----
A0A8C8SQS1_BCL2L11      -----------------------------gttgaa----aggccaa----
                                                     * **      * * * *    

A0A8C8R9Q6_BAD-01       ggtcggaccccgcatctc--------------------------------
A0A8C8RL12_BMF-01       -ggcaacccaaaca-ctcagcccatcctcttccactcaggatgtcatgtt
A0A8C8SQS1_BCL2L11      -gtcagcctcagcatcttagacc---------------------------
                         * *   *    ** **                                 

A0A8C8R9Q6_BAD-01       ------tggagccagaa----------------gctcaggatgagccagg
A0A8C8RL12_BMF-01       gccttgtggagtcactgaagagccccagagactcttctatgggaat--gc
A0A8C8SQS1_BCL2L11      ------tggggccccta----------------cctctatacaaac--ac
                              *** * *                      **      *      

A0A8C8R9Q6_BAD-01       tggggcattcttccggggccgctcccactcagcccc----------cccc
A0A8C8RL12_BMF-01       tgggtaccgtttacatg--ccccgccagttggctttgcattgaatccaca
A0A8C8SQS1_BCL2L11      agtatcaagattccagg-----tgccagtctgcctc------aatacat-
                         *        ** *  *       *** *  **             *   

A0A8C8R9Q6_BAD-01       catcctatgggctgctatgcgttatgggcgggaactgcgcaggatgagtg
A0A8C8RL12_BMF-01       cctccaagaggagcctcaggaaggacaacgggaa--gcacatgcggaggt
A0A8C8SQS1_BCL2L11      -----------------------gaagacatgca--gc-----cagaaat
                                                    *  * *  **       **   

A0A8C8R9Q6_BAD-01       acgagtttgacgtggctctacaggtgctgccacgccccaggagtgcaggc
A0A8C8RL12_BMF-01       tcagattg----------cacggaagttacagtgc------attgcagac
A0A8C8SQS1_BCL2L11      atggattg----------cacaggaattgcggcgt------attggagat
                             **            ** *    * *   *       * ** **  

A0A8C8R9Q6_BAD-01       acagcatcac-agctgcaccgggggagcagctggaaggagactatccagg
A0A8C8RL12_BMF-01       -cagttccacaggctccacatacagaggcatcagcagaatagaaatcaag
A0A8C8SQS1_BCL2L11      -gagtttaat-gcctcc----------------------tattgcccaag
                          **    *    ** *                       *     ** *

A0A8C8R9Q6_BAD-01       cctggttggggcacaagcctgcccgtgatgtcccccg-------------
A0A8C8RL12_BMF-01       tgtggt---ggcagatactt--ct----cttcctacataacttggcctt-
A0A8C8SQS1_BCL2L11      aagggc---atcaattgctttctt----cgtcttccctgctttggagctg
                           **      **    * *          **   *              

A0A8C8R9Q6_BAD-01       --------aaaagccccaagtgactgcagcccccctgcggtggagatggg
A0A8C8RL12_BMF-01       --------aaatg---tggaggcaaacagg--aaccatg-c--aggtcag
A0A8C8SQS1_BCL2L11      cagagaggaaatgccctggattgggacagtcccatcacgtc--aagcgag
                                *** *             ***         *    *     *

A0A8C8R9Q6_BAD-01       accagccccttga
A0A8C8RL12_BMF-01       agg-------tga
A0A8C8SQS1_BCL2L11      ttc-------taa
                                  * *

© 1998-2022Legal notice