Dataset for CDS classical BH3-containing proteins of organism Pavo cristatus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A8C9EIW6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Pavo cristatus GN=BCL2L11 (length=690 residues).
atggccaagcagccccccgaggcgaaggcgccccgcgaccgccgggccgggcggctgccgccgggagaggggccgggccc
ggccgtcccgctgcggcccggagcccccgccgcgctgcccggcgccgcccggcccgcctcgcccggcagccccggcccgt
tcgccatccgctcgccgctcttcttcttcgtgcggaggtccccgctgctgccgcgctcctccagcgggtacttctccttc
gaggccgagcgcagccccgcgcccatgagctgcgataaggccacgcagacccccagcccgccgtgccaggccgtcagcca
ctacctgagcgccatggcttccaggtggcgatctcactcactcgcagaagaaatacaaccagaaatatggattgcacagg
agctgcggcgcatcggggatgaattcaatgcctcctattgtccgagaagggtaattttcttatttttactttccatttct
ttacgcacagcctctaaaagggaaaagcttaatcatatctggaaactagctctgtggcaagtgttttgctcactcaaatg
tagaaaaggatgcgcgggtggctgtcgtctgctgccgccgcgtcattcaatacactcagcatcacctttcgagttgggac
cggagattttcgggtgtcgtggcttcattcatggtactgagagccagtaa
>gnl|bcl2dbcds|A0A8C9F3R5_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Pavo cristatus GN=BMF (length=753 residues).
caccgttcacctaagaacaccccaaccccacgctcagagaggccgaagagcaggagaggaacggcagcacttctagcagc
gccgggcccggccgcgcccccggaggccggttctccatcggctcgactctcccgcccctctcctcaaccgttcccgggcc
gccctctcgcgcgcggcggccgttgccgctcggcccccccgctgctcattggctgtcgggcgggggcggggcccgcgcgg
cgggggtggggctgccgtcagctgttcgccgtgcgctcggcggcggcggcagtttggcggtggggaggcgcagtgacggt
tcccgctctaggggcgcccccgtccctgtgggacgcccggcccggcccggcccggcccggcccgctcggcggagcaatgg
atcgccccagctacctggaagaggactattctggcctggatgggctggacgatgacgtgtttcactctgatgactttgga
cttgcagggaatgctggttaccgcttacacgtccctccagttggctttgcattggatccaaatctccaagaagagcctca
ggaaggtcagcaggaggcgcgtactgaggtgcagattgcgcggaagttgcagtgcattgcagaccagttccaccggctcc
acatacagcggcatcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaacgtg
gaggcgaacaggaaccgcactgggcagaggtga
>gnl|bcl2dbcds|A0A8C9F3R5_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Pavo cristatus GN=BMF (length=540 residues).
atggatcgccccagctacctggaagaggactattctggcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccatcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgcttacacgtccctccagttggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
aggaggcgcgtactgaggtgcagattgcgcggaagttgcagtgcattgcagaccagttccaccggctccacatacagcgg
gtagggtgcttccagaggntgcaaattacagaaaacgatgaacaaccacaagctttttag
>gnl|bcl2dbcds|A0A8C9F456_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Pavo cristatus GN=PMAIP1 (length=345 residues).
atgcccggcaagacgatacgcaaacctgcgccgcccgccgcgcccgcaggtagggaaagacgaaaggagacaggtctcaa
ttttgggggggaagttgatactggaaaaaaacatgctttttccttttgcttttcctttttcttctttaccttcttctttc
tttcaccgatatcgctacctggaaaagacctcgttagaattaaatccccgtctccctgcgcgtgttttgcagagcgggac
gcggtgactgagtgtgcactggagctgcgcaggatcggagacaaggcggacctgcggcagaaggtcctgaacctcatcac
gaaactcttctgccgcaaaacgtga
© 1998-2022Legal notice