Dataset for CDS classical BH3-containing proteins of organism Pavo cristatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9F456_PMAIP1-      ----------------atgcccggca------------------------
A0A8C9EIW6_BCL2L11      ---------------atggccaagcagccccccg----------------
A0A8C9F3R5_BMF-01       caccgttcacctaagaacaccc--caaccccacgctcagagaggccgaag
A0A8C9F3R5_BMF-02       -----------atggatcgccc--cagctacctg----------------
                                           **   **                        

A0A8C9F456_PMAIP1-      ---agacga-----------------------------------------
A0A8C9EIW6_BCL2L11      ---aggcgaagg--------cgccccgcgaccgccgggccgggcggctgc
A0A8C9F3R5_BMF-01       agcaggagaggaacggcagcacttctagcagcgccgggcccggccgc-gc
A0A8C9F3R5_BMF-02       ----gaagagga-------ctattctggcctggatgggctggac------
                            *  **                                         

A0A8C9F456_PMAIP1-      --------------------------------------------------
A0A8C9EIW6_BCL2L11      cgccgggagaggggcc-----gggcccggccgtcccgctgcggcccggag
A0A8C9F3R5_BMF-01       ccccggaggccggttctccatcggctcgactctcccgcccctctcctcaa
A0A8C9F3R5_BMF-02       -----gatgacgtgtttc----------actctgatgactttggacttg-
                                                                          

A0A8C9F456_PMAIP1-      -------tacgcaaacctgcgccg--------------------------
A0A8C9EIW6_BCL2L11      cccccgccgcgctgcccggcgccg-----cccggcccgcctcgcccggca
A0A8C9F3R5_BMF-01       ccgttcccgggccgccctctcgcg-----cgcggcggccgttgccgc---
A0A8C9F3R5_BMF-02       -------caggtcagcctggtgagatgactgcaactggcattttcacaca
                                  *    **      *                          

A0A8C9F456_PMAIP1-      --------------------------------------------------
A0A8C9EIW6_BCL2L11      gccccggcccgttcgccatccgctcgccgctcttc----------ttctt
A0A8C9F3R5_BMF-01       ---tcggcccccccgctgctcattggctgtcgggcgggggcggggcccgc
A0A8C9F3R5_BMF-02       gaaccagtcctacagctgccttctgg------------------------
                                                                          

A0A8C9F456_PMAIP1-      -----------------------------cccgccgcgcccgcag-----
A0A8C9EIW6_BCL2L11      cgtgcggaggt---------ccccgctgctgccgcgctcctccagcgggt
A0A8C9F3R5_BMF-01       gcggcgggggtggggctgccgtcagctg-ttcgccgtgcgctcggcggcg
A0A8C9F3R5_BMF-02       -----ggaggt---------ttcaactatttcccctcacacactgctgtg
                                                       *  *   *   * *     

A0A8C9F456_PMAIP1-      ---------------------gtag-----------ggaaagacga----
A0A8C9EIW6_BCL2L11      acttctccttcgaggccgagcgcagccccgcgcccatgagctgcgat---
A0A8C9F3R5_BMF-01       gcggcagtttggcggtgg---ggaggc---------gcagtgacggttcc
A0A8C9F3R5_BMF-02       gt-----cccggtgtcag---gcatcc---------tgagcagcaggac-
                                             * *              *    *      

A0A8C9F456_PMAIP1-      -------aagg----------------agaca---ggtct---caatttt
A0A8C9EIW6_BCL2L11      -------aaggccacgc----------agacccccagcccg--ccgtgcc
A0A8C9F3R5_BMF-01       cgctctaggggcgcccccgtccctgtgggacgcccggcccggcccggccc
A0A8C9F3R5_BMF-02       -------aaggcaactc----------aaacactcagcccatcctcttcc
                                 **                  **     * *    *      

A0A8C9F456_PMAIP1-      ggggggga------------------agttgata----------------
A0A8C9EIW6_BCL2L11      aggccgtc------------------agccactacctgagcgccatggct
A0A8C9F3R5_BMF-01       ggcccggc-------ccgctcggcggag-caatg---gatcgccccagct
A0A8C9F3R5_BMF-02       agtcaggatgttatgttgccttgtggagtcactg---aagagcccc----
                         *   *                    **    *                 

A0A8C9F456_PMAIP1-      --ctggaaaaaaacatgcttttt---------------------------
A0A8C9EIW6_BCL2L11      tccaggtggcgatctcactcactcgcagaagaaatacaaccagaaatatg
A0A8C9F3R5_BMF-01       acctggaagaggacta-ttctggcctggatgggctggacgatgacgtgtt
A0A8C9F3R5_BMF-02       --------ggagactc-ttctat---------------------------
                                     *    *                               

A0A8C9F456_PMAIP1-      -----------------------------------------ccttttgct
A0A8C9EIW6_BCL2L11      gattgcacaggagctgcggcgcatcggggatgaattcaatgcctcctat-
A0A8C9F3R5_BMF-01       tcactctgatgactttggacttgcagggaatg--ctggttaccgcttaca
A0A8C9F3R5_BMF-02       -------------------------gggaatg--ctggttaccgcttaca
                                                                 **   *   

A0A8C9F456_PMAIP1-      tttcc-------tttttcttctttaccttcttctttctttcaccgatatc
A0A8C9EIW6_BCL2L11      tgtccgagaagggtaattttcttatttttactttccatt---------tc
A0A8C9F3R5_BMF-01       cgtcc---------------ctccagttggctttgcattggatccaaatc
A0A8C9F3R5_BMF-02       cgtcc---------------ctccagttggctttgcattggatccaaatc
                          ***               **     *   * *   **         **

A0A8C9F456_PMAIP1-      gcta-------cctggaaaaga------cctcgttagaattaaatccccg
A0A8C9EIW6_BCL2L11      tttacgcacagcctctaaaagggaaaagcttaatcatatctggaaactag
A0A8C9F3R5_BMF-01       tccaagaagagcctcaggaagg----------------------------
A0A8C9F3R5_BMF-02       tccaagaagagcctcaggaagg----------------------------
                           *       ***    ***                             

A0A8C9F456_PMAIP1-      tctccctgcgcgtgttttgcagagcgggacgcggtgactgagtgtgcact
A0A8C9EIW6_BCL2L11      ctctgtggcaagtgttttgctcactcaaatgtagaaa---aggatgcgcg
A0A8C9F3R5_BMF-01       -tcagcaggagg-----cgcgtactgaggtgcaga--------ttgcgcg
A0A8C9F3R5_BMF-02       -tcagcaggagg-----cgcgtactgaggtgcaga--------ttgcgcg
                               *   *      **  *       *  *          *** * 

A0A8C9F456_PMAIP1-      ggagctgcgcaggatcggagacaaggcggacc---------------tgc
A0A8C9EIW6_BCL2L11      g--gtggctgtcgtctgc-------tgccgccgcgtcattcaatacactc
A0A8C9F3R5_BMF-01       gaagttgcagtgcattgcagaccagttccaccggctc------cacatac
A0A8C9F3R5_BMF-02       gaagttgcagtgcattgcagaccagttccaccggctc------cacatac
                        *  *  **        *             **                 *

A0A8C9F456_PMAIP1-      ggcagaaggtcctgaacctcatcacgaaa-------------ctcttctg
A0A8C9EIW6_BCL2L11      agcatcacctttcgagttgggaccggaga------------------ttt
A0A8C9F3R5_BMF-01       agcggcatcagcagaacagaaatcaagtgtggtggcagctttttctcttt
A0A8C9F3R5_BMF-02       agcgg---------------------gtagggtg-------------ctt
                         **                                             * 

A0A8C9F456_PMAIP1-      ccgcaaaacgtga-------------------------------------
A0A8C9EIW6_BCL2L11      tcgggtgtcgtggcttcattcatggtactgagagccagtaa---------
A0A8C9F3R5_BMF-01       ctacacaacttggccttaaac----g--tggaggcgaacaggaaccgca-
A0A8C9F3R5_BMF-02       ccaga------ggntgcaaat----tacagaaaacgatgaacaaccacaa
                                   *                                      

A0A8C9F456_PMAIP1-      ---------------
A0A8C9EIW6_BCL2L11      ---------------
A0A8C9F3R5_BMF-01       -ctgggcagaggtga
A0A8C9F3R5_BMF-02       gctttttag------
                                       

© 1998-2022Legal notice