Dataset for CDS classical BH3-containing proteins of organism Papio anubis

[Download (right click)] [Alignment] [Repertoires]

11 sequence(s)

>gnl|bcl2dbcds|A0A096MLD5_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Papio anubis GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaagccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacgcggagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagc
acagcgttatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggc
aggggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A096MLD5_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Papio anubis GN=BAD (length=492 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaagccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagagcttggtattctccttcttgggaatctgaggactctgaaaatcccagt
gcaaggatgctcgcggaagcatcagcaccgatgtctgccccagccactgactcagaagcccaacacgcagagaatgtaaa
gctgaaggcgctggggctgtggagacgcggagtcgccacagctcctaccccgcggggacggaggaggacgaagggatgga
ggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|A0A096MPU8_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Papio anubis GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccaacgcgggctcaggcagagctcgaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|A0A096MPU8_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Papio anubis GN=PMAIP1 (length=399 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccaacgcgggctcaggcaggacaggcagggacggcagggac
ggcgagggaccaggccggatttgggattgggatgcagctgcatttcaccagaagcaaaaagctcgtctcctcctccccac
ttgcccttccgcggggccacgaggaacaagtgcaagtagctcgaagtcgagtgtgctactcaactcaggagatttggaga
caaactgaacttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaacctgactgcatcaaaaacttg
catagggggactccaaaagagactttttctcaggagatgcacacttcatcaatttgaagaaagattgcattgtaattgg
>gnl|bcl2dbcds|A0A096N944_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Papio anubis GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgtttggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgcttggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A096NKG5_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Papio anubis GN=BIK (length=483 residues).
atgtctggagttagacccatctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggacgagatggatgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctgggtctggctttcatctacgaccagacggacgacatcagggatgttcttagaagttt
catggatggtttcaccacccttagggagaacataatgaggttctggagatccccgaatcccaggtcctgggtgtcccgtg
aacaggtgctgctggcgctgctgctgctgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctcaag
tga
>gnl|bcl2dbcds|A0A096NTE9_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Papio anubis GN=BMF (length=621 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggtggaccctaggtataaaaa
tgcaagaagatcagttaggaaattaaaggcttctagctttctcagctgccagcctgagtga
>gnl|bcl2dbcds|A0A096NTE9_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Papio anubis GN=BMF (length=390 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtaactgaggaaccccagcgactcttttacgcaccagcagaaccgaaatcgcgtgtggt
ggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggtggaccctag
>gnl|bcl2dbcds|A0A096NYC3_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Papio anubis GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A096NYC3_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Papio anubis GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgtt
gcgttacattgtccgcctggtgtggaggatgcattga
>gnl|bcl2dbcds|A0A2I3N2Z9_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Papio anubis GN=BBC3 (length=396 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggcttcttctgcgacgtgggtcccctgcca
gatttgtggtcctcagccctcgctcttgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgaaatggagcccaattag
© 1998-2020Legal notice