Dataset for CDS classical BH3-containing proteins of organism Papio anubis

[Download (right click)] [Edit] [Sequences] [Repertoires]

24 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A096MPU8_PMAIP1-      atg------------------------cctggg---------aagaaggc
A0A096MPU8_PMAIP1-      atg------------------------cctggg---------aagaaggc
A0A096NYC3_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc--gagaaggt
A0A096NYC3_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc--gagaaggt
A0A096NYC3_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc--gagaaggt
A0A096NYC3_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc--gagaaggt
A0A096NYC3_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc--gagaaggt
A0A096NYC3_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc--gagaaggt
A0A096NYC3_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc--gagaaggt
A0A096NYC3_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc--gagaaggt
A0A096NYC3_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc--gagaaggt
A0A096NYC3_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc--gagaaggt
A0A096NKG5_BIK-01       atg-----------------------tctggagttagacccat-------
A0A096NTE9_BMF-02       atggagcc----------------atctcggtgtgtg-----gaggagct
A0A096NTE9_BMF-03       atggagcc----------------atctcggtgtgtg-----gaggagct
A0A096NTE9_BMF-01       atggagcc----------------atctcggtgtgtg-----gaggagct
A0A096MLD5_BAD-03       atgttccag---------------atcccagagtttgagcctagtgagca
A0A096MLD5_BAD-02       atgttccag---------------atcccagagtttgagcctagtgagca
A0A096MLD5_BAD-04       atgttccag---------------atcccagagtttgagcctagtgagca
A0A096MLD5_BAD-01       atgttccag---------------atcccagagtttgagcctagtgagca
A0A096N944_HRK-01       atg--------------------------------t--------------
A0A2I3N2Z9_BBC3-02      ataaaattt---------------ggcgtggggtct--------------
A0A2I3N2Z9_BBC3-01      ataaaattt---------------ggcgtggggtct--------------
A0A2I3N2Z9_BBC3-03      ataaaattt---------------ggcgtggggtct--------------
                        **                                                

A0A096MPU8_PMAIP1-      gcgcaagaacgcgcaaccg-------------------------------
A0A096MPU8_PMAIP1-      gcgcaagaacgcgcaaccg-------------------------------
A0A096NYC3_BCL2L11      agacaattgcagcctgcgg-----------------------------ag
A0A096NYC3_BCL2L11      agacaattgcagcctgcgg-----------------------------ag
A0A096NYC3_BCL2L11      agacaattgcagcctgcgg-----------------------------ag
A0A096NYC3_BCL2L11      agacaattgcagcctgcgg-----------------------------ag
A0A096NYC3_BCL2L11      agacaattgcagcctgcgg-----------------------------ag
A0A096NYC3_BCL2L11      agacaattgcagcctgcgg-----------------------------ag
A0A096NYC3_BCL2L11      agacaattgcagcctgcgg-----------------------------ag
A0A096NYC3_BCL2L11      agacaattgcagcctgcgg-----------------------------ag
A0A096NYC3_BCL2L11      agacaattgcagcctgcgg-----------------------------ag
A0A096NYC3_BCL2L11      agacaattgcagcctgcgg-----------------------------ag
A0A096NKG5_BIK-01       -------------ctccagagacatcttgatggagaccctcctgtatgag
A0A096NTE9_BMF-02       ggaggatgatgtgttccag-------------------ccggaggacggg
A0A096NTE9_BMF-03       ggaggatgatgtgttccag-------------------ccggaggacggg
A0A096NTE9_BMF-01       ggaggatgatgtgttccag-------------------ccggaggacggg
A0A096MLD5_BAD-03       ggaaga-------ctccag-------------------atctgcagagag
A0A096MLD5_BAD-02       ggaaga-------ctccag-------------------ctctgcagagag
A0A096MLD5_BAD-04       ggaaga-------ctccag-------------------atctgcagagag
A0A096MLD5_BAD-01       ggaaga-------ctccag-------------------ctctgcagagag
A0A096N944_HRK-01       --------------------------------------------------
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
                                                                          

A0A096MPU8_PMAIP1-      -agcccaacgcgggctcaggcag---------------------------
A0A096MPU8_PMAIP1-      -agcccaacgcgggctcaggcaggacaggcagggacggcagggacggcga
A0A096NYC3_BCL2L11      aggcct-------ccccagctcag--------------------------
A0A096NYC3_BCL2L11      aggcct-------ccccagctcag--------------------------
A0A096NYC3_BCL2L11      aggcct-------ccccagctcag--------------------------
A0A096NYC3_BCL2L11      aggcct-------ccccagctcag--------------------------
A0A096NYC3_BCL2L11      aggcct-------ccccagctcag--------------------------
A0A096NYC3_BCL2L11      aggcct-------ccccagctcag--------------------------
A0A096NYC3_BCL2L11      aggcct-------ccccagctcag--------------------------
A0A096NYC3_BCL2L11      aggcct-------ccccagctcag--------------------------
A0A096NYC3_BCL2L11      aggcct-------ccccagctcag--------------------------
A0A096NYC3_BCL2L11      aggcct-------ccccagctcag--------------------------
A0A096NKG5_BIK-01       cagctcctggaacccctaaccatggaggttcttggtgtgactgaccctga
A0A096NTE9_BMF-02       gagccggggg----cccaacccgggag----------ct-cgctctctgc
A0A096NTE9_BMF-03       gagccggggg----cccaacccgggag----------ct-cgctctctgc
A0A096NTE9_BMF-01       gagccggggg----cccaacccgggag----------ct-cgctctctgc
A0A096MLD5_BAD-03       gggcctgggc----cccagccccgcgggggacaagccct-cagactccgg
A0A096MLD5_BAD-02       gggcctgggc----cccagccccgcgggggacaagccct-cagactccgg
A0A096MLD5_BAD-04       gggcctgggc----cccagccccgcgggggacaagccct-cagactccgg
A0A096MLD5_BAD-01       gggcctgggc----cccagccccgcgggggacaagccct-cagactccgg
A0A096N944_HRK-01       --gcccgtgc---cccctgcaccgc-------------------------
A0A2I3N2Z9_BBC3-02      --gcccgggcatgtccatgccaggt-------------------------
A0A2I3N2Z9_BBC3-01      --gcccgggcatgtccatgccaggt-------------------------
A0A2I3N2Z9_BBC3-03      --gcccgggcatgtccatgccaggt-------------------------
                          **          *                                   

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      gg--------------gaccaggccggatttgggattgggatgcagctgc
A0A096NYC3_BCL2L11      ----------------acctggggcccc--------tacctccctacaga
A0A096NYC3_BCL2L11      ----------------acctggggcccc--------tacctccctacaga
A0A096NYC3_BCL2L11      ----------------acctggggcccc--------tacctccctacaga
A0A096NYC3_BCL2L11      ----------------acctggggcccc--------tacctccctacaga
A0A096NYC3_BCL2L11      ----------------acctggggcccc--------tacctccctacaga
A0A096NYC3_BCL2L11      ----------------acctggggcccc--------tacctccctacaga
A0A096NYC3_BCL2L11      ----------------acctggggcccc--------tacctccctacaga
A0A096NYC3_BCL2L11      ----------------acctggggcccc--------tacctccctacaga
A0A096NYC3_BCL2L11      ----------------acctggggcccc--------tacctccctacaga
A0A096NYC3_BCL2L11      ----------------acctggggcccc--------tacctccctacaga
A0A096NKG5_BIK-01       agag------------gacctggaccctatggaggacttcgatcctttgg
A0A096NTE9_BMF-02       cgatctgttt------gcccagagcctacttgactgccccctcagccgac
A0A096NTE9_BMF-03       cgatctgttt------gcccagagcctacttgactgccccctcagccgac
A0A096NTE9_BMF-01       cgatctgttt------gcccagagcctacttgactgccccctcagccgac
A0A096MLD5_BAD-03       caagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagc
A0A096MLD5_BAD-02       caagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagc
A0A096MLD5_BAD-04       caagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagc
A0A096MLD5_BAD-01       caagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagc
A0A096N944_HRK-01       ----------------ggccgcggc-cccccggccgtgtgcgcctgcagc
A0A2I3N2Z9_BBC3-02      ----------------gcccagggcttcttctgcgacgtgggtcccctgc
A0A2I3N2Z9_BBC3-01      ----------------gcccagggcttcttctgcgacgtgggtcccctgc
A0A2I3N2Z9_BBC3-03      ----------------gcccagggcttcttctgcgacgtgggtcccctgc
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      atttcaccagaagcaaa---------------------------------
A0A096NYC3_BCL2L11      ca--------gagccac---------------------------------
A0A096NYC3_BCL2L11      ca--------gagccac---------------------------------
A0A096NYC3_BCL2L11      ca--------gagccac---------------------------------
A0A096NYC3_BCL2L11      ca--------gagccac---------------------------------
A0A096NYC3_BCL2L11      ca--------gagccac---------------------------------
A0A096NYC3_BCL2L11      ca--------gagccac---------------------------------
A0A096NYC3_BCL2L11      ca--------gagccac---------------------------------
A0A096NYC3_BCL2L11      ca--------gagccac---------------------------------
A0A096NYC3_BCL2L11      ca--------gagccac---------------------------------
A0A096NYC3_BCL2L11      ca--------gagccac---------------------------------
A0A096NKG5_BIK-01       agtgtatggaggacagt---------------------------------
A0A096NTE9_BMF-02       tt--------cagctct---------------------------------
A0A096NTE9_BMF-03       tt--------cagctct---------------------------------
A0A096NTE9_BMF-01       tt--------cagctct---------------------------------
A0A096MLD5_BAD-03       ag--------gagcagc---------------------------------
A0A096MLD5_BAD-02       ag--------gagcagc---------------------------------
A0A096MLD5_BAD-04       ag--------gagcagc---------------------------------
A0A096MLD5_BAD-01       ag--------gagcagc---------------------------------
A0A096N944_HRK-01       gc--------gggtcgt---------------------------------
A0A2I3N2Z9_BBC3-02      ca--------gatttgt---------------------------------
A0A2I3N2Z9_BBC3-01      ca--------gatttgtggccccagggagcgccatggcccgcgcacgcca
A0A2I3N2Z9_BBC3-03      ca--------gatttgt---------------------------------
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096MLD5_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A096MLD5_BAD-04       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      ggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgc
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096MLD5_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A096MLD5_BAD-04       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      gccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctc
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096MLD5_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A096MLD5_BAD-04       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      tgcgagcccggcctggctgccgcccccgccgcccccgccctgctgcccgc
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096MLD5_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A096MLD5_BAD-04       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      tgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctgg
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096MLD5_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A096MLD5_BAD-04       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      ggggcccccgctggcctgggggtccccgcagccggccccgaggcccacgc
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      ------------------------------------aagctcgtctcctc
A0A096NYC3_BCL2L11      ------a-------------------------------------------
A0A096NYC3_BCL2L11      ------a-------------------------------------------
A0A096NYC3_BCL2L11      ------aaggtaatcccgaaggcaatcacggaggtgaaggggacagctgc
A0A096NYC3_BCL2L11      ------aaggtaatcccgaaggcaatcacggaggtgaaggggacagctgc
A0A096NYC3_BCL2L11      ------a-------------------------------------------
A0A096NYC3_BCL2L11      ------a-------------------------------------------
A0A096NYC3_BCL2L11      ------aaggtaatcccgaaggcaatcacggaggtgaaggggacagctgc
A0A096NYC3_BCL2L11      ------aaggtaatcccgaaggcaatcacggaggtgaaggggacagctgc
A0A096NYC3_BCL2L11      ------aaggtaatcccgaaggcaatcacggaggtgaaggggacagctgc
A0A096NYC3_BCL2L11      ------aaggtaatcccgaaggcaatcacggaggtgaaggggacagctgc
A0A096NKG5_BIK-01       ------------------------------------gacatgttggccct
A0A096NTE9_BMF-02       ------------------------------------------------tc
A0A096NTE9_BMF-03       ------------------------------------------------tc
A0A096NTE9_BMF-01       ------------------------------------------------tc
A0A096MLD5_BAD-03       ------------------------------------------------ca
A0A096MLD5_BAD-02       ------------------------------------------------ca
A0A096MLD5_BAD-04       ------------------------------------------------ca
A0A096MLD5_BAD-01       ------------------------------------------------ca
A0A096N944_HRK-01       ------------------------------------------ttggggct
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      ccggacggtcctcagccctcgctcttgctggcggagcagcacctggagtc
A0A2I3N2Z9_BBC3-03      ------ggtcctcagccctcgctcttgctggcggagcagcacctggagtc
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      ctccccacttgcccttccgcggggccacgaggaac---------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      ccccacggcagccctcagggcccgctggccccaccggccagccctggccc
A0A096NYC3_BCL2L11      ccccacggcagccctcagggcccgctggccccaccggccagccctggccc
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      ccccacggcagccctcagggcccgctggccccaccggccagccctggccc
A0A096NYC3_BCL2L11      ccccacggcagccctcagggcccgctggccccaccggccagccctggccc
A0A096NYC3_BCL2L11      ccccacggcagccctcagggcccgctggccccaccggccagccctggccc
A0A096NYC3_BCL2L11      ccccacggcagccctcagggcccgctggccccaccggccagccctggccc
A0A096NKG5_BIK-01       gcggctggcctgcatcggggacgag-------------------------
A0A096NTE9_BMF-02       cctctcacccactgctgtggccctggccttcgacccaccagcca------
A0A096NTE9_BMF-03       cctctcacccactgctgtggccctggccttcgacccaccagcca------
A0A096NTE9_BMF-01       cctctcacccactgctgtggccctggccttcgacccaccagcca------
A0A096MLD5_BAD-03       accagcagcagccatcatggagggacttcctcgcccg-------------
A0A096MLD5_BAD-02       accagcagcagccatcatggagggagagcttggtattctccttcttggga
A0A096MLD5_BAD-04       accagcagcagccatcatgg------------------------------
A0A096MLD5_BAD-01       accagcagcagccatcatgg------------------------------
A0A096N944_HRK-01       gcgctcgtccgccgc-----------------------------------
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      gcccgtgcccagcgccccgggggccctggcgggcggtcccacccaggcgg
A0A2I3N2Z9_BBC3-03      gcccgtgcccagcgccccgggggccctggcgggcggtcccacccaggcgg
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      ttttgctaccagatcc----------------------------------
A0A096NYC3_BCL2L11      ttttgctaccagatcc----------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      ttttgctaccagatcc----------------------------------
A0A096NYC3_BCL2L11      ttttgctaccagatcc----------------------------------
A0A096NYC3_BCL2L11      ttttgctaccagatcc----------------------------------
A0A096NYC3_BCL2L11      ttttgctaccagatcc----------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096MLD5_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       atctgaggactctgaaaatcccagtgcaaggatgctcgcggaagcatcag
A0A096MLD5_BAD-04       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      ccccgggagtccgcggggaggaggaaca----------------------
A0A2I3N2Z9_BBC3-03      ccccgggagtccgcggggaggaggaaca----------------------
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096MLD5_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       caccgatgtctgccccagccactgactcagaagcccaacacgcagagaat
A0A096MLD5_BAD-04       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
                                                                          

A0A096MPU8_PMAIP1-      --------------------agctcgaagtcgagtgtgctactcaactc-
A0A096MPU8_PMAIP1-      ----------aagtgcaagtagctcgaagtcgagtgtgctactcaactc-
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      ----------ccgcttttcatctttatgagaagatcctccctgctgtctc
A0A096NYC3_BCL2L11      ----------ccgcttttcatctttatgagaagatcctccctgctgtctc
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      ----------ccgcttttcatctttatgagaagatcctccctgctgtctc
A0A096NYC3_BCL2L11      ----------ccgcttttcatctttatgagaagatcctccctgctgtctc
A0A096NYC3_BCL2L11      ----------ccgcttttcatctttatgagaagatcctccctgctgtctc
A0A096NYC3_BCL2L11      ----------ccgcttttcatctttatgagaagatcctccctgctgtctc
A0A096NKG5_BIK-01       ----------atggatgtgagcctcagggccccgcgcctggcccagctct
A0A096NTE9_BMF-02       ----------ggaagacaaggccacccagaccc----tcggcccagcctc
A0A096NTE9_BMF-03       ----------ggaagacaaggccacccagaccc----tcggcccagcctc
A0A096NTE9_BMF-01       ----------ggaagacaaggccacccagaccc----tcggcccagcctc
A0A096MLD5_BAD-03       ----------aagagcgcgggc-acagcgacgcagatgcggcaaagctcc
A0A096MLD5_BAD-02       gtaaagctgaaggcgctggggctgtggagacgcggagtcgccacagctcc
A0A096MLD5_BAD-04       ----------aggcgctggggctgtggagacgcggagtcgccacagctcc
A0A096MLD5_BAD-01       ----------aggcgctggggctgtggagacgcggagtcgccacagctcc
A0A096N944_HRK-01       -------------------------------------gcagctcaccgcc
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      ----------gtgggcccgggagatcggggcccagctgcggcggatggcg
A0A2I3N2Z9_BBC3-03      ----------gtgggcccgggagatcggggcccagctgcggcggatggcg
                                                                          

A0A096MPU8_PMAIP1-      ------------------------------aggagatttggagacaaact
A0A096MPU8_PMAIP1-      ------------------------------aggagatttggagacaaact
A0A096NYC3_BCL2L11      -------------------------------agac-------------ag
A0A096NYC3_BCL2L11      -------------------------------agac-------------ag
A0A096NYC3_BCL2L11      gatcctccagtgggtatttctcttttgacacagac-------------ag
A0A096NYC3_BCL2L11      gatcctccagtgggtatttctcttttgacacagac-------------ag
A0A096NYC3_BCL2L11      -------------------------------agac-------------ag
A0A096NYC3_BCL2L11      -------------------------------agac-------------ag
A0A096NYC3_BCL2L11      gatcctccagtgggtatttctcttttgacacagac-------------ag
A0A096NYC3_BCL2L11      gatcctccagtgggtatttctcttttgacacagac-------------ag
A0A096NYC3_BCL2L11      gatcctccagtgggtatttctcttttgacacagac-------------ag
A0A096NYC3_BCL2L11      gatcctccagtgggtatttctcttttgacacagac-------------ag
A0A096NKG5_BIK-01       ------------------------ctgaggtggccatgcacagcctgggt
A0A096NTE9_BMF-02       ccccagccaaggtgtcatgctgccttgtggggta---------actgagg
A0A096NTE9_BMF-03       ccccagccaaggtgtcatgctgccttgtggggta---------actgagg
A0A096NTE9_BMF-01       ccccagccaaggtgtcatgctgccttgtggggta---------actgagg
A0A096MLD5_BAD-03       agctggacgcgagtcttccagtcctggtgggatcggaacttgggcagggg
A0A096MLD5_BAD-02       taccccgcgggga-----------cggaggaggacgaagggatggaggag
A0A096MLD5_BAD-04       taccccgcgggga-----------cggaggaggacgaagggatggaggag
A0A096MLD5_BAD-01       taccccgcgggga-----------cggaggaggacgaagggatggaggag
A0A096N944_HRK-01       gcccggctcaagg-----------cgcttggcgacgagctgc-accagcg
A0A2I3N2Z9_BBC3-02      ----------------------------------------gagacaagag
A0A2I3N2Z9_BBC3-01      gacgacctcaacg-----------cgcagtacgagcggcggagacaagag
A0A2I3N2Z9_BBC3-03      gacgacctcaacg-----------cgcagtacgagcggcggagacaagag
                                                                          

A0A096MPU8_PMAIP1-      gaact---------------------------------------------
A0A096MPU8_PMAIP1-      gaact---------------------------------------------
A0A096NYC3_BCL2L11      gagcc----------cagcaccc-----------------atgagttgtg
A0A096NYC3_BCL2L11      gagcc----------cagcaccc-----------------atgagttgtg
A0A096NYC3_BCL2L11      gagcc----------cagcaccc-----------------atgagttgtg
A0A096NYC3_BCL2L11      gagcc----------cagcaccc-----------------atgagttgtg
A0A096NYC3_BCL2L11      gagcc----------cagcaccc-----------------atgagttgtg
A0A096NYC3_BCL2L11      gagcc----------cagcaccc-----------------atgagttgtg
A0A096NYC3_BCL2L11      gagcc----------cagcaccc-----------------atgagttgtg
A0A096NYC3_BCL2L11      gagcc----------cagcaccc-----------------atgagttgtg
A0A096NYC3_BCL2L11      gagcc----------cagcaccc-----------------atgagttgtg
A0A096NYC3_BCL2L11      gagcc----------cagcaccc-----------------atgagttgtg
A0A096NKG5_BIK-01       ---------------ctggctttcatctacgaccagacggacgacatcag
A0A096NTE9_BMF-02       aaccc----------cagcgactcttttacggcaatgctggctaccggct
A0A096NTE9_BMF-03       aaccc----------cagcgactcttttacg-------------------
A0A096NTE9_BMF-01       aaccc----------cagcgactcttttacggcaatgctggctaccggct
A0A096MLD5_BAD-03       aagct----------ccgccccc----tcc-cagtgaccttcgctccacg
A0A096MLD5_BAD-02       gagcc----------cagcccct----ttcggggccgctcgcgctccgcg
A0A096MLD5_BAD-04       gagcc----------cagcccct----ttcggggccgctcgcgctccgcg
A0A096MLD5_BAD-01       gagcc----------cagcccct----ttcggggccgctcgcgctccgcg
A0A096N944_HRK-01       caccatgtggcggcgccgcgcgcggagccggagggcgccggcgcccggcg
A0A2I3N2Z9_BBC3-02      gagca-gcagcgacaccgcccctcgccctggagg--------gtcctgta
A0A2I3N2Z9_BBC3-01      gagca-gcagcgacaccgcccctcgccctggagg--------gtcctgta
A0A2I3N2Z9_BBC3-03      gagca-gcagcgacaccgcccctcgccctggagg--------gtcctgta
                                                                          

A0A096MPU8_PMAIP1-      -------------tccggcagaaacttctgaatctgatagccaa------
A0A096MPU8_PMAIP1-      -------------tccggcagaaacttctgaatctgatagccaa------
A0A096NYC3_BCL2L11      acaa---------atcaacacaaaccccaagtcctccttgcca-------
A0A096NYC3_BCL2L11      acaa---------atcaacacaaaccccaagtcctccttgcca-------
A0A096NYC3_BCL2L11      acaa---------atcaacacaaaccccaagtcctccttgcca-------
A0A096NYC3_BCL2L11      acaa---------atcaacacaaaccccaagtcctccttgcca-------
A0A096NYC3_BCL2L11      acaa---------atcaacacaaaccccaagtcctccttgcca-------
A0A096NYC3_BCL2L11      acaa---------atcaacacaaaccccaagtcctccttgcca-------
A0A096NYC3_BCL2L11      acaa---------atcaacacaaaccccaagtcctccttgcca-------
A0A096NYC3_BCL2L11      acaa---------atcaacacaaaccccaagtcctccttgcca-------
A0A096NYC3_BCL2L11      acaa---------atcaacacaaaccccaagtcctccttgcca-------
A0A096NYC3_BCL2L11      acaa---------atcaacacaaaccccaagtcctccttgcca-------
A0A096NKG5_BIK-01       ggat---------gttcttagaagtttcatggat----------------
A0A096NTE9_BMF-02       tcct---------ctccctgccagtttcccggcagtcttgcccatcgggg
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-01       tcct---------ctccctgccagtttcccggcagtcttgcccatcgggg
A0A096MLD5_BAD-03       ccccgaaactccacccgct------ctcactgtcct--------------
A0A096MLD5_BAD-02       cccc------ccaacctctgggcagcacagcgttat--------------
A0A096MLD5_BAD-04       cccc------ccaacctctgggcagcacagcgttat--------------
A0A096MLD5_BAD-01       cccc------ccaacctctgggcagcacagcgttat--------------
A0A096N944_HRK-01       cgct---------ccccac------ctactggccct--------------
A0A2I3N2Z9_BBC3-02      caat---------ctcatcatgggactcctgccctt--------------
A0A2I3N2Z9_BBC3-01      caat---------ctcatcatgggactcctgccctt--------------
A0A2I3N2Z9_BBC3-03      caat---------ctcatcatgggactcctgccctt--------------
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------ggccttcaaccact----------------------
A0A096NYC3_BCL2L11      --------------ggccttcaaccact----------------------
A0A096NYC3_BCL2L11      --------------ggccttcaaccact----------------------
A0A096NYC3_BCL2L11      --------------ggccttcaaccact----------------------
A0A096NYC3_BCL2L11      --------------ggccttcaaccact----------------------
A0A096NYC3_BCL2L11      --------------ggccttcaaccact----------------------
A0A096NYC3_BCL2L11      --------------ggccttcaaccact----------------------
A0A096NYC3_BCL2L11      --------------ggccttcaaccact----------------------
A0A096NYC3_BCL2L11      --------------ggccttcaaccact----------------------
A0A096NYC3_BCL2L11      --------------ggccttcaaccact----------------------
A0A096NKG5_BIK-01       --------------ggtttcaccacccttagggagaacataatgaggttc
A0A096NTE9_BMF-02       agcagccccccgaagggcagtggcaacatcgagcagaggtacagattgcc
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-01       agcagccccccgaagggcagtggcaacatcgagcagaggtacagattgcc
A0A096MLD5_BAD-03       --------------ggtcggccatcttggatatgggcggaagtgcttccc
A0A096MLD5_BAD-02       --------------ggccgcgagctccgga----ggatga----------
A0A096MLD5_BAD-04       --------------ggccgcgagctccgga----ggatgagtgacgagtt
A0A096MLD5_BAD-01       --------------ggccgcgagctccgga----ggatgagtgacgagtt
A0A096N944_HRK-01       --------------ggctgtgcgcggccgc--------------------
A0A2I3N2Z9_BBC3-02      --------------acccaggggccacaga--------------------
A0A2I3N2Z9_BBC3-01      --------------acccaggggccacaga--------------------
A0A2I3N2Z9_BBC3-03      --------------acccaggggccacaga--------------------
                                                                          

A0A096MPU8_PMAIP1-      -----actcttctgctcagga-----acctga------------------
A0A096MPU8_PMAIP1-      -----actcttctgctcagga-----acctgactgcatcaaaaacttgca
A0A096NYC3_BCL2L11      -----atctcagtgcaatggtagtcattctagaggatataggtgatagtt
A0A096NYC3_BCL2L11      -----atctcagtgcaatgga-----t-----gag---------------
A0A096NYC3_BCL2L11      -----atctcagtgcaatggt-----t-----------------------
A0A096NYC3_BCL2L11      -----atctcagtgcaat--------------------------------
A0A096NYC3_BCL2L11      -----atctcagtgcaatggc-----ttccaggag---------------
A0A096NYC3_BCL2L11      -----atctcagtgcaatggc-----ttccaggag---------------
A0A096NYC3_BCL2L11      -----atctcagtgcaatggc-----ttccaggag---------------
A0A096NYC3_BCL2L11      -----atctcagtgcaatggc-----ttccaggag---------------
A0A096NYC3_BCL2L11      -----atctcagtgcaatggc-----ttccaggag---------------
A0A096NYC3_BCL2L11      -----atctcagtgcaatggc-----taactgg-----------------
A0A096NKG5_BIK-01       tggagatccccgaatcccagg-----tcctgggtgtcccgtgaacaggtg
A0A096NTE9_BMF-02       cgaaagcttcagtgcattgca-----gaccagttccaccggctccatgtg
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-01       cgaaagcttcagtgcattgca-----gaccagttccaccggctccatgtg
A0A096MLD5_BAD-03       tcaggccttatgcaaaagagg-----atccgtgctccctctttcggtggg
A0A096MLD5_BAD-02       --------------------------------------------------
A0A096MLD5_BAD-04       tgtggactccttt---aaggg-----acttcctcgcccgaagagcgcggg
A0A096MLD5_BAD-01       tgtggactcctttaagaaggg-----acttcctcgcccgaagagcgcggg
A0A096N944_HRK-01       -----gc------------------------------------aggtggc
A0A2I3N2Z9_BBC3-02      -----gcccccgaaatggag----------------cccaattaggtgcc
A0A2I3N2Z9_BBC3-01      -----gcccccgaaatggag----------------cccaattaggtgcc
A0A2I3N2Z9_BBC3-03      -----gcccccgaaatggag----------------cccaattag-----
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      tagggggactccaaaagagactttttctcaggagatgcacacttcatcaa
A0A096NYC3_BCL2L11      cattgtggtttggatttatatttactggcttagatttgtatggccacc--
A0A096NYC3_BCL2L11      ----gccactggatcct---------ccctcgga-------attgccc--
A0A096NYC3_BCL2L11      -------------------------------agagaaatag---------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      ----gcaggctgaacctgcagatatgcgcccggagatacggatcgcccaa
A0A096NYC3_BCL2L11      ----gcaggctgaacctgcagatatgcgcccggagatacggatcgcccaa
A0A096NYC3_BCL2L11      ----gcaggctgaacctgcagatatgcgcccggagatacggatcgcccaa
A0A096NYC3_BCL2L11      ----gcaggctgaacctgcagatatgcgcccggagatacggatcgcccaa
A0A096NYC3_BCL2L11      ----gcaggctgaacctgcagatatgcgcccggagatacggatcgcccaa
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NKG5_BIK-01       -----------------------------ctgctggcgctgctgctgctg
A0A096NTE9_BMF-02       cagcaacaccagca--gaaccgaaatcgcgtgtggtggcagatcctcctc
A0A096NTE9_BMF-03       ------caccagca--gaaccgaaatcgcgtgtggtggcagatcctcctc
A0A096NTE9_BMF-01       cagcaacaccagca--gaaccgaaatcgcgtgtggtggcagatcctcctc
A0A096MLD5_BAD-03       agggctgacccaga--ttc------------------------ccttccg
A0A096MLD5_BAD-02       --------------------------------------------------
A0A096MLD5_BAD-04       cacagcgacgcaga--tgcggcaaagctccagctggacgcgagtcttcca
A0A096MLD5_BAD-01       cacagcgacgcaga--tgcggcaaagctccagctggacgcgagtcttcca
A0A096N944_HRK-01       ggcgctggc-----------------ggcctgg-----------------
A0A2I3N2Z9_BBC3-02      tgcacccgcccggt--ggacgtcagggacttggggggcaggcccctccca
A0A2I3N2Z9_BBC3-01      tgcacccgcccggt--ggacgtcagggacttggggggcaggcccctccca
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      tttgaagaaagattgcattgtaattgg-----------------------
A0A096NYC3_BCL2L11      ------------accacagtcaagatacagaacaactcaaccacaaggat
A0A096NYC3_BCL2L11      ------------ttcatagggaagttcagtggccactg------------
A0A096NYC3_BCL2L11      ------------------------------------------aggaagtt
A0A096NYC3_BCL2L11      ----------------------------------------------gggt
A0A096NYC3_BCL2L11      gagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggt
A0A096NYC3_BCL2L11      gagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggt
A0A096NYC3_BCL2L11      gagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggt
A0A096NYC3_BCL2L11      gagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggat
A0A096NYC3_BCL2L11      gagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggtt
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NKG5_BIK-01       ctggcactgctgct-----------------ggcgctgctcagcgggggc
A0A096NTE9_BMF-02       ttcctgcacaaccttgctttgaatggagaagagaacaggaacggggtgga
A0A096NTE9_BMF-03       ttcctgcacaaccttgctttgaatggagaagagaacaggaacggggtgga
A0A096NTE9_BMF-01       ttcctgcacaaccttgctttgaatggagaagagaacaggaacggggtgga
A0A096MLD5_BAD-03       gtgcatgtga----------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A096MLD5_BAD-04       gtcctggtgggatc-----------------ggaacttgggcaggggaag
A0A096MLD5_BAD-01       gtcctggtgggatc-----------------ggaacttgggcaggggaag
A0A096N944_HRK-01       ------------ct-----------------gc----tcggcaggcggaa
A0A2I3N2Z9_BBC3-02      cctcctgacaccct-----------------gg----ccagcgcggggga
A0A2I3N2Z9_BBC3-01      cctcctgacaccct-----------------gg----ccagcgcggggga
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NYC3_BCL2L11      ttc-----------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      gtc-----------------------------------------------
A0A096NYC3_BCL2L11      attttt--------------------------------------------
A0A096NYC3_BCL2L11      attttt--------------------------------------------
A0A096NYC3_BCL2L11      attttt--------------------------------------------
A0A096NYC3_BCL2L11      attttt--------------------------------------------
A0A096NYC3_BCL2L11      gtcgcttcca----------------------------------------
A0A096NYC3_BCL2L11      agag----------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NKG5_BIK-01       ctgcacctgctg--------------------------------------
A0A096NTE9_BMF-02       ccctaggcccctgacctggaatggggccgttgtcaaa-------------
A0A096NTE9_BMF-03       ccctag--------------------------------------------
A0A096NTE9_BMF-01       ccctaggtataaaaatgcaagaagatcagttaggaaattaaaggcttcta
A0A096MLD5_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A096MLD5_BAD-04       ctccgccccc----------------------------------------
A0A096MLD5_BAD-01       ctccgccccc----------------------------------------
A0A096N944_HRK-01       ct------------------------------------------------
A0A2I3N2Z9_BBC3-02      ctttctctgc----------------------------------------
A0A2I3N2Z9_BBC3-01      ctttctctgc----------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------tcatga------------------------
A0A096NYC3_BCL2L11      --------------------gaatggttagcatcaagctaa---------
A0A096NYC3_BCL2L11      --------------------gtgtag------------------------
A0A096NYC3_BCL2L11      --------------------gaataa------------------------
A0A096NYC3_BCL2L11      --------------------gaataattaccaagcagccgaagaccaccc
A0A096NYC3_BCL2L11      --------------------gaataattaccaagcagccgaagaccaccc
A0A096NYC3_BCL2L11      --------------------gaataattaccaagcagccgaagaccaccc
A0A096NYC3_BCL2L11      -----------------cctgattaa------------------------
A0A096NYC3_BCL2L11      --------------------aaatag------------------------
A0A096NYC3_BCL2L11      --------------------gactag------------------------
A0A096NKG5_BIK-01       -----------------ctcaagtga------------------------
A0A096NTE9_BMF-02       -----------------ccctgttga------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-01       gctttctcagctgccagcctgagtga------------------------
A0A096MLD5_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A096MLD5_BAD-04       -----------------tcccagtga------------------------
A0A096MLD5_BAD-01       -----------------tcccagtga------------------------
A0A096N944_HRK-01       ---------------------tgtag------------------------
A0A2I3N2Z9_BBC3-02      -----------------accatgtag------------------------
A0A2I3N2Z9_BBC3-01      -----------------accatgtag------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      acaaatggttatcttacgactgttgcgttacattgtccgcctggtgtgga
A0A096NYC3_BCL2L11      acaaatggttatcttacgactgttgcgttacattgtccgcctggtgtgga
A0A096NYC3_BCL2L11      acaaatggttatcttacgactgttgcgttacattgtccgcctggtgtgga
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096MLD5_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A096MLD5_BAD-04       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
                                                                          

A0A096MPU8_PMAIP1-      -----------
A0A096MPU8_PMAIP1-      -----------
A0A096NYC3_BCL2L11      -----------
A0A096NYC3_BCL2L11      -----------
A0A096NYC3_BCL2L11      -----------
A0A096NYC3_BCL2L11      -----------
A0A096NYC3_BCL2L11      ggatgcattga
A0A096NYC3_BCL2L11      ggatgcattga
A0A096NYC3_BCL2L11      ggatgcattga
A0A096NYC3_BCL2L11      -----------
A0A096NYC3_BCL2L11      -----------
A0A096NYC3_BCL2L11      -----------
A0A096NKG5_BIK-01       -----------
A0A096NTE9_BMF-02       -----------
A0A096NTE9_BMF-03       -----------
A0A096NTE9_BMF-01       -----------
A0A096MLD5_BAD-03       -----------
A0A096MLD5_BAD-02       -----------
A0A096MLD5_BAD-04       -----------
A0A096MLD5_BAD-01       -----------
A0A096N944_HRK-01       -----------
A0A2I3N2Z9_BBC3-02      -----------
A0A2I3N2Z9_BBC3-01      -----------
A0A2I3N2Z9_BBC3-03      -----------
                                   

© 1998-2020Legal notice