Dataset for CDS classical BH3-containing proteins of organism Papio anubis

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A096MPU8_PMAIP1-      atgc---------------------------ctgggaagaaggcgcgcaa
A0A096MPU8_PMAIP1-      atgc---------------------------ctgggaagaaggcgcgcaa
A0A096NKG5_BIK-01       atgt------------ctggagttagacccatctccagagacatcttgat
A0A096N944_HRK-01       atgt-----------------gcccgtgccccctgca-------------
A0A096NYC3_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A096NYC3_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A096MLD5_BAD-01       atgttccag--a--tcccagagtttgagcctagtg--agcaggaaga---
A0A096MLD5_BAD-02       atgttccag--a--tcccagagtttgagcctagtg--agcaggaaga---
A0A2I3N2Z9_BBC3-03      ataa---aa------tttggcgtggggtctgcccg------ggcatg---
A0A096NTE9_BMF-01       atgg---agcca--tctcggtgtgtggaggagctggaggatgatgtg---
A0A096NTE9_BMF-03       atgg---agcca--tctcggtgtgtggaggagctggaggatgatgtg---
                        **                                                

A0A096MPU8_PMAIP1-      gaacgcgcaaccgagcccaacgcgggctcaggcag---------------
A0A096MPU8_PMAIP1-      gaacgcgcaaccgagcccaacgcgggctcaggcaggacaggcagggacgg
A0A096NKG5_BIK-01       ggagaccctcctgtatga-gcagctcctggaac-----------------
A0A096N944_HRK-01       ----ccgcggcc-------gcggccccccggcc-----------------
A0A096NYC3_BCL2L11      acaattgcagcc-tgcggagaggcctccccagc-----------------
A0A096NYC3_BCL2L11      acaattgcagcc-tgcggagaggcctccccagc-----------------
A0A096MLD5_BAD-01       ----ctccagctctgcagagaggggcctgggcc-----------------
A0A096MLD5_BAD-02       ----ctccagctctgcagagaggggcctgggcc-----------------
A0A2I3N2Z9_BBC3-03      ----tccatgcc--------aggtgcccagggc-----------------
A0A096NTE9_BMF-01       ----ttccagccggaggacggggagccgggggc-----------------
A0A096NTE9_BMF-03       ----ttccagccggaggacggggagccgggggc-----------------
                                  *               *     *                 

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      cagggacggcgagggaccaggccggatttgggattgggatgcagctgcat
A0A096NKG5_BIK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      ttcaccagaagcaaaaagctcgtctcctcctccccacttgcccttccgcg
A0A096NKG5_BIK-01       ----ccctaaccatggag-----gttcttggtgtgactg--accctgaag
A0A096N944_HRK-01       ----gtgtgcgcctgcagcgcgggtcgtttggggctgcgctcgtccgccg
A0A096NYC3_BCL2L11      ----tcagacc--tggggcccctacctccctacagacag--agccacaag
A0A096NYC3_BCL2L11      ----tcagacc--tggggcccctacctccctacagacag--agccacaag
A0A096MLD5_BAD-01       ----ccagccccgcgggggacaagccctc------------agactccgg
A0A096MLD5_BAD-02       ----ccagccccgcgggggacaagccctc------------agactccgg
A0A2I3N2Z9_BBC3-03      ----ttcttc---tgcgacgtgggtcccctgccagatttgtggtcctcag
A0A096NTE9_BMF-01       ----ccaacc---cggga-gctcgctctctgccgatctgtttgcccagag
A0A096NTE9_BMF-03       ----ccaacc---cggga-gctcgctctctgccgatctgtttgcccagag
                                                                          

A0A096MPU8_PMAIP1-      ------------------------agctcgaagtcgagtgtgctactcaa
A0A096MPU8_PMAIP1-      gggccacgaggaacaagtgcaagtagctcgaagtcgagtgtgctactcaa
A0A096NKG5_BIK-01       aggacctggacccta------------tggaggacttcgatcctttggag
A0A096N944_HRK-01       cgcagctcaccgccgcc------------------------------cgg
A0A096NYC3_BCL2L11      gtaatcccgaaggcaatcacggaggtgaaggggacagctgc------ccc
A0A096NYC3_BCL2L11      gtaatcccgaaggcaatcacggaggtgaaggggacagctgc------ccc
A0A096MLD5_BAD-01       caagcatcatcgccag---------gccccaggcctcctgt---------
A0A096MLD5_BAD-02       caagcatcatcgccag---------gccccaggcctcctgt---------
A0A2I3N2Z9_BBC3-03      ccctcgctcttgctggcggagcagcacctggagtcgcccgtgcccagcgc
A0A096NTE9_BMF-01       cctacttgactgccccctcagccg-acttcagctcttccctctcacccac
A0A096NTE9_BMF-03       cctacttgactgccccctcagccg-acttcagctcttccctctcacccac
                                                                          

A0A096MPU8_PMAIP1-      ctcaggagatttggagacaaactgaacttcc-------------------
A0A096MPU8_PMAIP1-      ctcaggagatttggagacaaactgaacttcc-------------------
A0A096NKG5_BIK-01       tgtatggaggacagtgacatgttggccctgcgg-------ctggcctgca
A0A096N944_HRK-01       ctcaaggcgcttggcgacgagctgcaccagcgcacca-------------
A0A096NYC3_BCL2L11      cacggcagccctcagggcccgctggccccaccggccagccctggcccttt
A0A096NYC3_BCL2L11      cacggcagccctcagggcccgctggccccaccggccagccctggcccttt
A0A096MLD5_BAD-01       ----gggacgccagtcaccagcaggagcagccaaccagcagcagccatca
A0A096MLD5_BAD-02       ----gggacgccagtcaccagcaggagcagccaaccagcagcagccatca
A0A2I3N2Z9_BBC3-03      cccgggggccctggcgggcggtc---ccacccaggcggccccgggagtcc
A0A096NTE9_BMF-01       tgctgtggccctggccttcgacc-caccagccaggaagacaaggccaccc
A0A096NTE9_BMF-03       tgctgtggccctggccttcgacc-caccagccaggaagacaaggccaccc
                                                      *                   

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NKG5_BIK-01       tcggggacgagatggatgtgagcctcagggccccgcgcctggcccagctc
A0A096N944_HRK-01       --------------------------------------------------
A0A096NYC3_BCL2L11      tgctaccagatccccgc-ttttcatctttatgagaagatcctccctgctg
A0A096NYC3_BCL2L11      tgctaccagatccccgc-ttttcatctttatgagaagatcctccctgctg
A0A096MLD5_BAD-01       tgg-----------------------------------------------
A0A096MLD5_BAD-02       tggagggagagcttggtattctccttcttgggaatctgaggactctgaaa
A0A2I3N2Z9_BBC3-03      gcggggagga---------------------ggaacagtgggcccgggag
A0A096NTE9_BMF-01       --------------------------------agaccctcggcccagcct
A0A096NTE9_BMF-03       --------------------------------agaccctcggcccagcct
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NKG5_BIK-01       tctgaggtggccatgcacagcct---------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A096NYC3_BCL2L11      tctcgatcctcc--------------------------------------
A0A096NYC3_BCL2L11      tctcgatcctcc--------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
A0A096MLD5_BAD-02       atcccagtgcaaggatgctcgcggaagcatcagcaccgatgtctgcccca
A0A2I3N2Z9_BBC3-03      atcggggccc----------------------------------------
A0A096NTE9_BMF-01       cccccagcca----------------------------------------
A0A096NTE9_BMF-03       cccccagcca----------------------------------------
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NKG5_BIK-01       -------------------------------------------gggtctg
A0A096N944_HRK-01       ----------------------------------------------tgtg
A0A096NYC3_BCL2L11      -------------------------------------------agtgggt
A0A096NYC3_BCL2L11      -------------------------------------------agtgggt
A0A096MLD5_BAD-01       -------------------------------------------aggcgct
A0A096MLD5_BAD-02       gccactgactcagaagcccaacacgcagagaatgtaaagctgaaggcgct
A0A2I3N2Z9_BBC3-03      -------------------------------------------agctg--
A0A096NTE9_BMF-01       -------------------------------------------aggtgtc
A0A096NTE9_BMF-03       -------------------------------------------aggtgtc
                                                                          

A0A096MPU8_PMAIP1-      -----------------ggcagaaa-------------------------
A0A096MPU8_PMAIP1-      -----------------ggcagaaa-------------------------
A0A096NKG5_BIK-01       gctttcatctacgaccagacggacg-acatcagggatgttctt-------
A0A096N944_HRK-01       gcggcgccgcgcgcggagccggagg-gcgccggcgccc------------
A0A096NYC3_BCL2L11      atttctcttttgacacagacaggag---cccagcacccat----------
A0A096NYC3_BCL2L11      atttctcttttgacacagacaggag---cccagcacccat----------
A0A096MLD5_BAD-01       ggggc----tgtggagacgcggagtcgccacagctcctaccccgcgggga
A0A096MLD5_BAD-02       ggggc----tgtggagacgcggagtcgccacagctcctaccccgcgggga
A0A2I3N2Z9_BBC3-03      ---------cggcggatggcggacg-acctcaacg---------------
A0A096NTE9_BMF-01       atgctgccttgtggggtaactgaggaaccccagcgactcttttacggcaa
A0A096NTE9_BMF-03       atgctgccttgtggggtaactgaggaaccccagcgactcttttacg----
                                           * *                            

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096MLD5_BAD-01       cgg-----------------------------------------------
A0A096MLD5_BAD-02       cgg-----------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A096NTE9_BMF-01       tgctggctaccggcttcctctccctgccagtttcccggcagtcttgccca
A0A096NTE9_BMF-03       --------------------------------------------------
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NKG5_BIK-01       ---------agaagtttcatggatggtttcaccacc--------------
A0A096N944_HRK-01       --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------gagttgtgacaa------------------
A0A096NYC3_BCL2L11      --------------------gagttgtgacaa------------------
A0A096MLD5_BAD-01       ---------aggaggacgaaggg---------------------------
A0A096MLD5_BAD-02       ---------aggaggacgaaggg---------------------------
A0A2I3N2Z9_BBC3-03      ---------cgcagtacgagcggcggagacaa------------------
A0A096NTE9_BMF-01       tcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacag
A0A096NTE9_BMF-03       --------------------------------------------------
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A096NTE9_BMF-01       attgcccgaaagcttcagtgcattgcagaccagttccaccggctccatgt
A0A096NTE9_BMF-03       --------------------------------------------------
                                                                          

A0A096MPU8_PMAIP1-      ---------------------------cttctgaatctgatagcc-----
A0A096MPU8_PMAIP1-      ---------------------------cttctgaatctgatagcc-----
A0A096NKG5_BIK-01       -------cttagggagaacataatgaggttctgg-------agatccccg
A0A096N944_HRK-01       -------ggcgcgctccccacctactggccctggctgtgcgcggccgcgc
A0A096NYC3_BCL2L11      -------atcaacacaaaccccaagtcctccttg-----ccaggcctt--
A0A096NYC3_BCL2L11      -------atcaacacaaaccccaagtcctccttg-----ccaggcctt--
A0A096MLD5_BAD-01       -------atggaggaggagcccagcccctttcgg--------ggccgc--
A0A096MLD5_BAD-02       -------atggaggaggagcccagcccctttcgg--------ggccgc--
A0A2I3N2Z9_BBC3-03      -------gaggagcagcagcgacaccgcccctcgccctggagggtcctgt
A0A096NTE9_BMF-01       gcagcaacaccagcagaaccgaaatcgcgtgtgg---tggcagatcct--
A0A096NTE9_BMF-03       -------caccagcagaaccgaaatcgcgtgtgg---tggcagatcct--
                                                                  *       

A0A096MPU8_PMAIP1-      aaactcttctgctcaggaacctg------a--------------------
A0A096MPU8_PMAIP1-      aaactcttctgctcaggaacctg------actg--------catcaaaaa
A0A096NKG5_BIK-01       aatcccaggtcctgggtgtcccgtgaacaggtgctgctggcgctgctgct
A0A096N944_HRK-01       agg-tggcggcgctggcggcctg------gctg---ctcggcaggcggaa
A0A096NYC3_BCL2L11      -caaccactatctcagtgcaatg------gcttccaggaggcaggctgaa
A0A096NYC3_BCL2L11      -caaccactatctcagtgcaatg------gcttccaggaggcaggctgaa
A0A096MLD5_BAD-01       ----tcgcgctccgcgcccccca------acct---ctgggcagcacagc
A0A096MLD5_BAD-02       ----tcgcgctccgcgcccccca------acct---ctgggcagcacagc
A0A2I3N2Z9_BBC3-03      acaatctcatcatgggactcctg------cccttacccaggggccacaga
A0A096NTE9_BMF-01       ----cctcttcctgcacaacctt------gctttgaatggagaagagaac
A0A096NTE9_BMF-03       ----cctcttcctgcacaacctt------gctttgaatggagaagagaac
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      cttgcatagggggactccaaaagagactttttctcaggagatgcacactt
A0A096NKG5_BIK-01       gctgctggcactgctgc-------------------------tggcgctg
A0A096N944_HRK-01       cttgtag-------------------------------------------
A0A096NYC3_BCL2L11      cctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaat
A0A096NYC3_BCL2L11      cctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaat
A0A096MLD5_BAD-01       gttatggccgcgagctc-------------------------cggaggat
A0A096MLD5_BAD-02       gttatggccgcgagctc-------------------------cggaggat
A0A2I3N2Z9_BBC3-03      gcccccgaaatggagcc-------------------------caattag-
A0A096NTE9_BMF-01       aggaacggggtggaccc-------------------------taggtata
A0A096NTE9_BMF-03       aggaacggggtggaccc-------------------------tag-----
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      catcaatttgaagaaagattgcattgtaattgg-----------------
A0A096NKG5_BIK-01       ctcagcgggggcctgcacctgctgctcaagtga-----------------
A0A096N944_HRK-01       --------------------------------------------------
A0A096NYC3_BCL2L11      cggagacgagtttaacgcttactatgcaaggaggttag------------
A0A096NYC3_BCL2L11      cggagacgagtttaacgcttactatgcaaggagggtatttttgaataatt
A0A096MLD5_BAD-01       gagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
A0A096MLD5_BAD-02       ga------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A096NTE9_BMF-01       aaaatgcaagaagatcagttaggaaattaaaggcttctagctttctcagc
A0A096NTE9_BMF-03       --------------------------------------------------
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A096NYC3_BCL2L11      ----------------------agaaatag--------------------
A0A096NYC3_BCL2L11      accaagcagccgaagaccacccacaaatggttatcttacgactgttgcgt
A0A096MLD5_BAD-01       gcgcgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtc
A0A096MLD5_BAD-02       --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A096NTE9_BMF-01       tgccagcctgagtga-----------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
                                                                          

A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      tacattgtccgcctggtgtggaggatgcattga-----------------
A0A096MLD5_BAD-01       ttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctc
A0A096MLD5_BAD-02       --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
                                                                          

A0A096MPU8_PMAIP1-      -------
A0A096MPU8_PMAIP1-      -------
A0A096NKG5_BIK-01       -------
A0A096N944_HRK-01       -------
A0A096NYC3_BCL2L11      -------
A0A096NYC3_BCL2L11      -------
A0A096MLD5_BAD-01       ccagtga
A0A096MLD5_BAD-02       -------
A0A2I3N2Z9_BBC3-03      -------
A0A096NTE9_BMF-01       -------
A0A096NTE9_BMF-03       -------
                               

© 1998-2020Legal notice