Dataset for CDS BCL2L11 of organism Papio anubis

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A096NYC3_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Papio anubis GN=BCL2L11 (length=879 residues).
atgttcccggcggctgcggccggggcagcgcggggcagaggcgcggcgtgcggagccctcggctgcccggcggagtgcgg
cggcgggctggcgggaaggcgcgggctgtgcgctgcgccgggtactctgaacccaagtccagagctttgtttcctgcgct
gccttcgtggtgacggtcagggggcgccgggtcggcgaagggcgcgggccagacgccccggggcccgggcccgggcccag
acgctacgctctgaagggaaggcgcggacaaaaaaagaccaaatggcaaagcaaccttctgatgtaagttctgagtgtga
ccgagaaggtagacaattgcagcctgcggagaggcctccccagctcagacctggggcccctacctccctacagacagagc
cacaaggtaatcccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctcagggcccgctggcccca
ccggccagccctggcccttttgctaccagatccccgcttttcatctttatgagaagatcctccctgctgtctcgatcctc
cagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctc
cttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctgcagatatgcgcccggagata
cggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggtatttttgaataattacca
agcagccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtccgcctggtgtggaggatgcattga
>gnl|bcl2dbcds|A0A096NYC3_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Papio anubis GN=BCL2L11 (length=699 residues).
atgttcccggcggctgcggccggggcagcgcggggcagaggcgcggcgtgcggagccctcggctgcccggcggagtgcgg
cggcgggctggcgggaaggcgcgggctgtgcgctgcgccgggtactctgaacccaagtccagagctttgtttcctgcgct
gccttcgtggtgacggtcagggggcgccgggtcggcgaagggcgcgggccagacgccccggggcccgggcccgggcccag
acgctacgctctgaagggaaggcgcggacaaaaaaagaccaaatggcaaagcaaccttctgatgtaagttctgagtgtga
ccgagaaggtagacaattgcagcctgcggagaggcctccccagctcagacctggggcccctacctccctacagacagagc
cacaagacaggagcccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccac
tatctcagtgcaatggcttccaggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcg
gcgaatcggagacgagtttaacgcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccac
aaatggttatcttacgactgttgcgttacattgtccgcctggtgtggaggatgcattga
>gnl|bcl2dbcds|A0A096NYC3_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Papio anubis GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggatgtcgcttccacctgattaa
>gnl|bcl2dbcds|A0A096NYC3_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Papio anubis GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A096NYC3_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Papio anubis GN=BCL2L11 (length=294 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgaggccactggatcctccctcgga
attgcccttcatagggaagttcagtggccactggaatggttagcatcaagctaa
>gnl|bcl2dbcds|A0A096NYC3_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Papio anubis GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcattctagaggatataggtgat
agttcattgtggtttggatttatatttactggcttagatttgtatggccaccaccacagtcaagatacagaacaactcaa
ccacaaggatttctcatga
© 1998-2022Legal notice