Dataset for CDS BCL2L11 of organism Papio anubis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A096NYC3_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A096NYC3_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
                        **************************************************

A0A096NYC3_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A096NYC3_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
                        **************************************************

A0A096NYC3_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A096NYC3_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
                        **************************************************

A0A096NYC3_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A096NYC3_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
                        **************************************************

A0A096NYC3_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A096NYC3_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
                        **************************************************

A0A096NYC3_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A096NYC3_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
                        **************************************************

A0A096NYC3_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A096NYC3_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                        **************************************************

A0A096NYC3_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A096NYC3_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
                        **************************************************

A0A096NYC3_BCL2L11      ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaa
A0A096NYC3_BCL2L11      ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaa
                        **************************************************

A0A096NYC3_BCL2L11      gagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggtt
A0A096NYC3_BCL2L11      gagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggt
                        ************************************************ *

A0A096NYC3_BCL2L11      ag----------------------------------agaaatag------
A0A096NYC3_BCL2L11      atttttgaataattaccaagcagccgaagaccacccacaaatggttatct
                        *                                   * **** *      

A0A096NYC3_BCL2L11      -----------------------------------------------
A0A096NYC3_BCL2L11      tacgactgttgcgttacattgtccgcctggtgtggaggatgcattga
                                                                       

© 1998-2020Legal notice