Dataset for CDS classical BH3-containing proteins of organism Panthera leo

[Download (right click)] [Alignment] [Repertoires]

11 sequence(s)

>gnl|bcl2dbcds|A0A8C8WD49_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Panthera leo GN=BMF (length=555 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctgtctgctaacctgtttgcccagagccagctggactgccccctcagccatctgcagctcttccctctcaccc
actgctgtggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccgagtcag
ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcattggcagcatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcaaaaccgccgtcgagtgtgg
tggcagattctcctcttcctacacaacctggctttgaatgcagaagagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A8C8WD49_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Panthera leo GN=BMF (length=837 residues).
atgaccagaaccagcccgggtcagaagaaaaggccaaggtgggagtggctctgggaaggcccagggaggaggtgtggagc
ctccttgagcagtgaggcaggccacatttggggagggtgtcatcctcagtggtactttatcaccaggtcgtttgtcatca
gtatcgggccccacttcccccaggtagaagggaaaggagaaaggaaagggggagtccttcaggttcggccttggggcagg
ggacagcaccccagatgcctgcattgcaccccagcaggggagatggagccgcctcagtgtgtggaggagctggaggatga
tgtgttccagccagaggatggggagccggggacccagcctgggagcttgctgtctgctaacctgtttgcccagagccagc
tggactgccccctcagccatctgcagctcttccctctcacccactgctgtggtcctgggcttcgacccaccagccaggaa
gacaaggccacccagaccctcagtccggcctccccgagtcagggtgtcatgctgccttgtggggtgaccgaagaacccca
gcgactcttttatggcaacgctggctaccggctccctctccctgccagtttccctgcaggcttgccccttggtgagcagc
cccctgaagggcattggcagcatcgagcagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccatcgg
cttcatatgcagcaacaccagcaaaaccgccgtcgagtgtggtggcagattctcctcttcctacacaacctggctttgaa
tgcagaagagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A8C8WWE4_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Panthera leo GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgcccctttcccct
cagccgcctggtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgccgcccccgccgcccccgccctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgaggtccgcgcccggacggtcctcagccctccctctcgccggcagagcagcacctggaatcgcc
ggtgcccagcgccccgggggccctggcgggcggccccacccaggcagccccgggagtccggggggaggaggagcagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgctgtacgagcggcggagacaagaggagcag
cagcgacaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgcccttacccagggcccgcggggc
cccggagatggagcccaattag
>gnl|bcl2dbcds|A0A8C8XBT3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Panthera leo GN=BAD (length=822 residues).
atggggaccccagagaatcccttatctgctcccacacacgtcccaggcacagggatgtcgggaactgagcagcgggaggc
gaggaagggacccaggacgaaggcggtaggctgggagcaagtcccgcggcgggggcggagactgggtcggaagcggccac
gccccctggccagccctagtgacatttcaaaagctgattgggccgggtcggtgacagttcccgttgcccaggcaactagg
gccgggctccctcagtactggaaggaggcggcaggcccgggtcaggggcctcgagatcgggcttgggcccagagcatgtt
ccagatcccagagtttgagcccagtgagcaggaagactccagccctacggataggggcctgggccccagccccacagggg
accggccccgcggccctggcaagcaccagcggacggccccaggcctcctcggggaagctggtcaccagcaggggcagccc
gccagcagcaaccaccatggaggcgctggggctgtggagacccggagtcgccacagctcgtaccccgccgggaccgagga
ggatgaagggacggaggaggaagagcccagccctttccggggtcgctcgcgctcagcgccccccaacctctgggccgccc
tgcgctacggccgcgagctccggaggatgagcgacgagttccagggctccttcaagggacttccacgcccgaagagcgcg
ggcacagcgacgcagatgcggcaaagccccagctggacgcgcttcatccagtcctggtgggatcggaacttggggagagg
aggctccgccccctcccagtga
>gnl|bcl2dbcds|A0A8C8XJH6_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Panthera leo GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggccgcctgggtctgcgctc
gtccgccgcgcagctcacggccgctcggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A8C8Y6N0_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Panthera leo GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccgggccttttgctaccagatccccgcttttcatctttgtcaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctc
aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttgcggcgtatcggagacgaatttaatgcatat
tacccaaggagggtctttttgaataattaccaagcagccgaagcccagccccaaatgattatcttacgactgttacgtta
catcgtccgcctgatatggcgattgcagcga
>gnl|bcl2dbcds|A0A8C8Y6N0_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Panthera leo GN=BCL2L11 (length=504 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccgggccttttgctaccagatccccgcttttcatctttgtcaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctc
aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttgcggcgtatcggagacgaatttaatgcatat
tacccaaggaggttagagcaatag
>gnl|bcl2dbcds|A0A8C8Y6N0_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Panthera leo GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctcaggctgta
cccgcagatatgcgcccggagatatggattgcacaagagttgcggcgtatcggagacgaatttaatgcatattacccaag
gagggtctttttgaataattaccaagcagccgaagcccagccccaaatgattatcttacgactgttacgttacatcgtcc
gcctgatatggcgattgcagcga
>gnl|bcl2dbcds|A0A8C8Y6N0_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Panthera leo GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaagcttccatgaggcagcctcaggctgtacccgcagata
tgcgcccggagatatggattgcacaagagttgcggcgtatcggagacgaatttaatgcatattacccaaggaggctggca
agagtaccggcatcctacatctga
>gnl|bcl2dbcds|A0A8C9D8E2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Panthera leo GN=BIK (length=447 residues).
atgtctcacgcaggatccctctccaggaacgtctttttgagcaccttcctgcaggagcatggcccggaagttctggacgt
tcctggcatgaccgatctcgtggagtactatgatcctgggccctcccctaacagcaacagccccgacgatgtggccatgc
ggctggccttcatcggggatgagatggaggtgaggtggatgatgccccgcgttggcgagctgcccgggatggccatgtac
agcttggccttcacctacaaccagacgggcctgagaggtgttctcagaagtctcgtggatggtctggccaacctcaggga
gaacatacggatctggggcttcctgaccctcaggaacagggtgtcccccaactccgggcgcgggctggcgctgtccctgc
tgctgctggtgttgctgctgggctgggggctccacctcctccagtga
>gnl|bcl2dbcds|A0A8C9D8H0_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Panthera leo GN=PMAIP1 (length=165 residues).
atgcctgggaagaggacgcgtaagagcgcgcagccgagccccgcgcgggccccggcagagcccgaagtggaatgtgccat
gcagctccggagatttggagacaaactgaatttccgacagaagcttatgaatctgatatccaaactcttccgctcgggaa
cctga
© 1998-2022Legal notice