Dataset for CDS classical BH3-containing proteins of organism Panthera leo

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9D8E2_BIK-01       --------------------------------------------------
A0A8C9D8H0_PMAIP1-      --------------------------------------------------
A0A8C8XJH6_HRK-01       --------------------------------------------------
A0A8C8WWE4_BBC3-01      --------------------------------------------------
A0A8C8XBT3_BAD-01       --------------------------------------------------
A0A8C8WD49_BMF-01       --------------------------------------------------
A0A8C8WD49_BMF-02       atgaccagaaccagcccgggtcagaagaaaaggccaaggtgggagtggct
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
                                                                          

A0A8C9D8E2_BIK-01       --------------------------------------------------
A0A8C9D8H0_PMAIP1-      --------------------------------------------------
A0A8C8XJH6_HRK-01       --------------------------------------------------
A0A8C8WWE4_BBC3-01      --------------------------------------------------
A0A8C8XBT3_BAD-01       --------------------------------------------------
A0A8C8WD49_BMF-01       --------------------------------------------------
A0A8C8WD49_BMF-02       ctgggaaggcccagggaggaggtgtggagcctccttgagcagtgaggcag
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
                                                                          

A0A8C9D8E2_BIK-01       --------------------------------------------------
A0A8C9D8H0_PMAIP1-      --------------------------------------------------
A0A8C8XJH6_HRK-01       --------------------------------------------------
A0A8C8WWE4_BBC3-01      --------------------------------------------------
A0A8C8XBT3_BAD-01       --------------------------------------------------
A0A8C8WD49_BMF-01       --------------------------------------------------
A0A8C8WD49_BMF-02       gccacatttggggagggtgtcatcctcagtggtactttatcaccaggtcg
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
                                                                          

A0A8C9D8E2_BIK-01       --------------------------------------------------
A0A8C9D8H0_PMAIP1-      --------------------------------------------------
A0A8C8XJH6_HRK-01       --------------------------------------------------
A0A8C8WWE4_BBC3-01      --------------------------------------------------
A0A8C8XBT3_BAD-01       --------------------------------------------------
A0A8C8WD49_BMF-01       --------------------------------------------------
A0A8C8WD49_BMF-02       tttgtcatcagtatcgggccccacttcccccaggtagaagggaaaggaga
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
                                                                          

A0A8C9D8E2_BIK-01       --------------------------------------------------
A0A8C9D8H0_PMAIP1-      --------------------------------------------------
A0A8C8XJH6_HRK-01       --------------------------------------------------
A0A8C8WWE4_BBC3-01      --------------------------------------------------
A0A8C8XBT3_BAD-01       --------------------------------------------------
A0A8C8WD49_BMF-01       --------------------------------------------------
A0A8C8WD49_BMF-02       aaggaaagggggagtccttcaggttcggccttggggcaggggacagcacc
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
                                                                          

A0A8C9D8E2_BIK-01       --------------------------------atgt--------------
A0A8C9D8H0_PMAIP1-      --------------------------------atg---------------
A0A8C8XJH6_HRK-01       --------------------------------atgt--------------
A0A8C8WWE4_BBC3-01      --------------------------------atgg--------------
A0A8C8XBT3_BAD-01       --------------------------------atggggaccccagagaat
A0A8C8WD49_BMF-01       --------------------------------atgg--------------
A0A8C8WD49_BMF-02       ccagatgcctgcattgcaccccagcaggggagatgg--------------
A0A8C8Y6N0_BCL2L11      --------------------------------atgg--------------
A0A8C8Y6N0_BCL2L11      --------------------------------atgg--------------
A0A8C8Y6N0_BCL2L11      --------------------------------atgg--------------
A0A8C8Y6N0_BCL2L11      --------------------------------atgg--------------
                                                        ***               

A0A8C9D8E2_BIK-01       --------------------------------------------------
A0A8C9D8H0_PMAIP1-      --------------------------------------------------
A0A8C8XJH6_HRK-01       --------------------------------------------------
A0A8C8WWE4_BBC3-01      -----------------------cccgagcac------gccagga---gg
A0A8C8XBT3_BAD-01       cccttatctgctcccacacacgtcccaggcacagggatgtcgggaactga
A0A8C8WD49_BMF-01       --------------------------------------------------
A0A8C8WD49_BMF-02       --------------------------------------------------
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
                                                                          

A0A8C9D8E2_BIK-01       -----------------------ctcacgcaggatccctctccaggaa--
A0A8C9D8H0_PMAIP1-      --------------------------------------------------
A0A8C8XJH6_HRK-01       --------------------------------------------------
A0A8C8WWE4_BBC3-01      gcagct----------------ccc----cggagcccgta----gagggc
A0A8C8XBT3_BAD-01       gcagcgggaggcgaggaagggacccaggacgaaggcggtaggctgggagc
A0A8C8WD49_BMF-01       ------------------------------agccgcc-------------
A0A8C8WD49_BMF-02       ------------------------------agccgcc-------------
A0A8C8Y6N0_BCL2L11      ---------------------------caaagcaaccttcagatgtaagt
A0A8C8Y6N0_BCL2L11      ---------------------------caaagcaaccttcagatgtaagt
A0A8C8Y6N0_BCL2L11      ---------------------------caaagcaaccttcagatgtaagt
A0A8C8Y6N0_BCL2L11      ---------------------------caaagcaaccttcagatgtaagt
                                                                          

A0A8C9D8E2_BIK-01       --------------------------------------------------
A0A8C9D8H0_PMAIP1-      --------------------------------------------------
A0A8C8XJH6_HRK-01       ------------------------------------gcccgtgccccctg
A0A8C8WWE4_BBC3-01      ctggcccgcgacg-----------------------gcccgcgccccttt
A0A8C8XBT3_BAD-01       aagtcccgcggcgggggcggagactgggtcggaagcggccacgccccctg
A0A8C8WD49_BMF-01       tcagtgtgtggagga---------------------gctggaggatgatg
A0A8C8WD49_BMF-02       tcagtgtgtggagga---------------------gctggaggatgatg
A0A8C8Y6N0_BCL2L11      tctgagtgtgacaga---------------------gaaggtggacaa--
A0A8C8Y6N0_BCL2L11      tctgagtgtgacaga---------------------gaaggtggacaa--
A0A8C8Y6N0_BCL2L11      tctgagtgtgacaga---------------------gaaggtggacaa--
A0A8C8Y6N0_BCL2L11      tctgagtgtgacaga---------------------gaaggtggacaa--
                                                                          

A0A8C9D8E2_BIK-01       -----cgtctttttgagcaccttcctgcaggagcatggcccgga------
A0A8C9D8H0_PMAIP1-      --------------------------------------------------
A0A8C8XJH6_HRK-01       caccgcggccgc-----ggcccccc------------ggccgtg------
A0A8C8WWE4_BBC3-01      cccctcagccgcctggtgccctc--------------ggccgtg------
A0A8C8XBT3_BAD-01       gc---cagc--cctagtgacatttcaaaagctgattgggccgggtcggtg
A0A8C8WD49_BMF-01       tgttccagccagaggatggggagccggggaccca---gcctgggagcttg
A0A8C8WD49_BMF-02       tgttccagccagaggatggggagccggggaccca---gcctgggagcttg
A0A8C8Y6N0_BCL2L11      --ttgcagcctgctgagaggcctcctcagctcag---gcctggggcc---
A0A8C8Y6N0_BCL2L11      --ttgcagcctgctgagaggcctcctcagctcag---gcctggggcc---
A0A8C8Y6N0_BCL2L11      --ttgcagcctgctgagaggcctcctcagctcag---gcctggggcc---
A0A8C8Y6N0_BCL2L11      --ttgcagcctgctgagaggcctcctcagctcag---gcctggggcc---
                                                                          

A0A8C9D8E2_BIK-01       --agttctggacgttcctg---gcatgaccgatctcgtggagtac-----
A0A8C9D8H0_PMAIP1-      ---------------cctgggaagaggac---------------------
A0A8C8XJH6_HRK-01       -----------tgcgcctgcagcgcgggcc--------------------
A0A8C8WWE4_BBC3-01      -----tcctgcggcctctgcgagcccggcctg---cccgccgccc-----
A0A8C8XBT3_BAD-01       acagttcccgttgcccaggcaactagggccgggctccctcagtactggaa
A0A8C8WD49_BMF-01       ctgtctgctaacctgtttgc--ccagagc---------------------
A0A8C8WD49_BMF-02       ctgtctgctaacctgtttgc--ccagagc---------------------
A0A8C8Y6N0_BCL2L11      -------cctacctctctacagacagagcagcaa----------------
A0A8C8Y6N0_BCL2L11      -------cctacctctctacagacagagcagcaaggtaatcctgaaggcg
A0A8C8Y6N0_BCL2L11      -------cctacctctctacagacagagcagcaaggtaatcctgaaggcg
A0A8C8Y6N0_BCL2L11      -------cctacctctctacagacagagcagca-----------------
                                                    *                     

A0A8C9D8E2_BIK-01       --------------------------------------------------
A0A8C9D8H0_PMAIP1-      --------------------------------------------------
A0A8C8XJH6_HRK-01       -------------------------------gcctgggtctgcgctc---
A0A8C8WWE4_BBC3-01      -----ccgccgcccccgccctgctgcccgccgcctacctctgcgccccca
A0A8C8XBT3_BAD-01       ggaggcggcaggcccgggtcaggggcctcgagatcgggcttgggcccaga
A0A8C8WD49_BMF-01       -------------------------------cagctggactgccccctca
A0A8C8WD49_BMF-02       -------------------------------cagctggactgccccctca
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      aaggggaccgctgcccccaaggcagccctcagggcccgctggccccacca
A0A8C8Y6N0_BCL2L11      aaggggaccgctgcccccaaggcagccctcagggcccgctggccccacca
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
                                                                          

A0A8C9D8E2_BIK-01       --------------------------------------------------
A0A8C9D8H0_PMAIP1-      --------------------------------------------------
A0A8C8XJH6_HRK-01       ----gtcc------------------------------------------
A0A8C8WWE4_BBC3-01      cc--gccccg----------------------------------------
A0A8C8XBT3_BAD-01       gcatgttccagat-------------------------------------
A0A8C8WD49_BMF-01       gccatctgcagctcttcc--------------------------------
A0A8C8WD49_BMF-02       gccatctgcagctcttcc--------------------------------
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      gccagccccgggccttttgctaccagatccccgcttttcatctttgtcag
A0A8C8Y6N0_BCL2L11      gccagccccgggccttttgctaccagatccccgcttttcatctttgtcag
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
                                                                          

A0A8C9D8E2_BIK-01       ------------------------------------------------ta
A0A8C9D8H0_PMAIP1-      ----------------------gcgtaagag-------------------
A0A8C8XJH6_HRK-01       ---------------gcc----gcgcag----------------------
A0A8C8WWE4_BBC3-01      ---cccgccgtcaccgcc----gccctggggggcccccgct---------
A0A8C8XBT3_BAD-01       ---cccagagtttgagcccagtgagcaggaagactccagccctacggata
A0A8C8WD49_BMF-01       ---ctctcacccactgctgtggtcct------------------------
A0A8C8WD49_BMF-02       ---ctctcacccactgctgtggtcct------------------------
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      aagatcctccctgctgtctcgatcctccagtgggtatttctcttttgaca
A0A8C8Y6N0_BCL2L11      aagatcctccctgctgtctcgatcctccagtgggtatttctcttttgaca
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
                                                                          

A0A8C9D8E2_BIK-01       tgatcctgggccctcccctaacagc--------------aacagccccga
A0A8C9D8H0_PMAIP1-      -----------------cgcgcag----------------ccgagccc--
A0A8C8XJH6_HRK-01       -----------------ctcacggc------------cgctcgg-ctcaa
A0A8C8WWE4_BBC3-01      --ggcctggg---ggtccccgcag----------------ccggccccga
A0A8C8XBT3_BAD-01       ggggcctgggccccagccccacagg------------ggaccggccccgc
A0A8C8WD49_BMF-01       -gggcttcgacccaccagccaggaa----gacaaggccacccagaccctc
A0A8C8WD49_BMF-02       -gggcttcgacccaccagccaggaa----gacaaggccacccagaccctc
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      cagacaggagcccggcacccatgagttgtgacaaatcaacacaaacccca
A0A8C8Y6N0_BCL2L11      cagacaggagcccggcacccatgagttgtgacaaatcaacacaaacccca
A0A8C8Y6N0_BCL2L11      -agacaggagcccggcacccatgagttgtgacaaatcaacacaaacccca
                                                                          

A0A8C9D8E2_BIK-01       cgatgtggccatg---------------------------------cggc
A0A8C9D8H0_PMAIP1-      ----------------------------------------------cgcg
A0A8C8XJH6_HRK-01       ggcgc------tc----------------------------ggcgacgag
A0A8C8WWE4_BBC3-01      ggtcc------gc----------------------------gcc--cgga
A0A8C8XBT3_BAD-01       ggccctggcaagc----------------------------accagcgga
A0A8C8WD49_BMF-01       agtccggcctccccgagtcagggtgtcatgctgccttgtggggtgaccga
A0A8C8WD49_BMF-02       agtccggcctccccgagtcagggtgtcatgctgccttgtggggtgaccga
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      agtcctccttgcc-------------------------------------
A0A8C8Y6N0_BCL2L11      agtcctccttgcc-------------------------------------
A0A8C8Y6N0_BCL2L11      agtcctccttgcc-------------------------------------
                                                                          

A0A8C9D8E2_BIK-01       tggccttcatcggggatgagatggaggtgagg------tggatgatgccc
A0A8C9D8H0_PMAIP1-      cgggccccggc---------------------------------------
A0A8C8XJH6_HRK-01       ctg-caccagc----------------------gcaccatgtggcggcgc
A0A8C8WWE4_BBC3-01      cggtcctcagc----------------------cctccct----------
A0A8C8XBT3_BAD-01       cgg-ccccagg----------------------cctcctcggggaagctg
A0A8C8WD49_BMF-01       agaaccccagcgactcttttatggcaacgctggctacc----ggctccct
A0A8C8WD49_BMF-02       agaaccccagcgactcttttatggcaacgctggctacc----ggctccct
A0A8C8Y6N0_BCL2L11      --------------------------------gcttccatgaggcagcct
A0A8C8Y6N0_BCL2L11      aggccttcaaccattatctcagtgcaa---tggcttccatgaggcagcct
A0A8C8Y6N0_BCL2L11      aggccttcaaccattatctcagtgcaa---tggcttccatgaggcagcct
A0A8C8Y6N0_BCL2L11      aggccttcaaccattatctcagtgcaa---tggcttccatgaggcagcct
                                                                          

A0A8C9D8E2_BIK-01       cgcgttggcga-------------------gctgcccgggatggccatgt
A0A8C9D8H0_PMAIP1-      -------agag------------------------cccgaagtggaatgt
A0A8C8XJH6_HRK-01       cgcgcgcggag------------------------ccggagggcgccggc
A0A8C8WWE4_BBC3-01      ctcgccggcag------------agcagca-----cctggaatcgccggt
A0A8C8XBT3_BAD-01       gtcaccagcaggggcagcccgccagcagcaaccaccatggaggcgctggg
A0A8C8WD49_BMF-01       ctccctgccag--------------------tttccctgcag--gcttgc
A0A8C8WD49_BMF-02       ctccctgccag--------------------tttccctgcag--gcttgc
A0A8C8Y6N0_BCL2L11      caggctg--------------------------tacccgcag--atatgc
A0A8C8Y6N0_BCL2L11      caggctg--------------------------tacccgcag--atatgc
A0A8C8Y6N0_BCL2L11      caggctg--------------------------tacccgcag--atatgc
A0A8C8Y6N0_BCL2L11      caggctg--------------------------tacccgcag--atatgc
                                                           *  *         * 

A0A8C9D8E2_BIK-01       aca---------------gcttggccttcacctacaaccagacgggcctg
A0A8C9D8H0_PMAIP1-      gcc------------------------------------atgcagctccg
A0A8C8XJH6_HRK-01       gcc--------------------cggcgcgctccccacctactggccctg
A0A8C8WWE4_BBC3-01      gcc-cagcgccccgggggccctggcgggcggccccacccaggcagccccg
A0A8C8XBT3_BAD-01       gctgtggagacccggagtcgccacagctcgtaccccgccgg---gaccga
A0A8C8WD49_BMF-01       ccc----------------ttggtgagcagccccctgaagggcattggca
A0A8C8WD49_BMF-02       ccc----------------ttggtgagcagccccctgaagggcattggca
A0A8C8Y6N0_BCL2L11      gcc-----------------------------------------------
A0A8C8Y6N0_BCL2L11      gcc-----------------------------------------------
A0A8C8Y6N0_BCL2L11      gcc-----------------------------------------------
A0A8C8Y6N0_BCL2L11      gcc-----------------------------------------------
                         *                                                

A0A8C9D8E2_BIK-01       ---------------agaggtgttctcag---------------------
A0A8C9D8H0_PMAIP1-      gagatttggagacaaactga------------------------------
A0A8C8XJH6_HRK-01       gctgtgcgcggccgcgcaggtg----------------------------
A0A8C8WWE4_BBC3-01      ggagtccgggggga-ggaggagcagtgggcccgg----------------
A0A8C8XBT3_BAD-01       ggaggatgaagggacggaggaggaa-gagcccagccctttccggggtcgc
A0A8C8WD49_BMF-01       gcatcgagcagaggtacagattgcccgaa---------------------
A0A8C8WD49_BMF-02       gcatcgagcagaggtacagattgcccgaa---------------------
A0A8C8Y6N0_BCL2L11      --------cggagatatggattgcacaag---------------------
A0A8C8Y6N0_BCL2L11      --------cggagatatggattgcacaag---------------------
A0A8C8Y6N0_BCL2L11      --------cggagatatggattgcacaag---------------------
A0A8C8Y6N0_BCL2L11      --------cggagatatggattgcacaag---------------------
                                          *                               

A0A8C9D8E2_BIK-01       -------------------------------------------------a
A0A8C9D8H0_PMAIP1-      -------------------------------------------------a
A0A8C8XJH6_HRK-01       --------------------------------------------------
A0A8C8WWE4_BBC3-01      --gagatcggggccc----------------------------------a
A0A8C8XBT3_BAD-01       tcgcgctcagcgccccccaacctctgggccgccctgcgctacggccgcga
A0A8C8WD49_BMF-01       -------------------------------------------------a
A0A8C8WD49_BMF-02       -------------------------------------------------a
A0A8C8Y6N0_BCL2L11      -------------------------------------------------a
A0A8C8Y6N0_BCL2L11      -------------------------------------------------a
A0A8C8Y6N0_BCL2L11      -------------------------------------------------a
A0A8C8Y6N0_BCL2L11      -------------------------------------------------a
                                                                          

A0A8C9D8E2_BIK-01       agtctcgtggatggtctggccaacctcagggagaacatacggatctgggg
A0A8C9D8H0_PMAIP1-      tttccgacagaag-------------------------------------
A0A8C8XJH6_HRK-01       --------------------------------------------------
A0A8C8WWE4_BBC3-01      gctgcggcggatgg-cggacga------------cctcaacgcgct----
A0A8C8XBT3_BAD-01       gctccggaggatga-gcgacgagttccagggctccttcaagggacttcca
A0A8C8WD49_BMF-01       gcttcagtgcattg-cagaccagttccatcggcttcatatgcagcaaca-
A0A8C8WD49_BMF-02       gcttcagtgcattg-cagaccagttccatcggcttcatatgcagcaaca-
A0A8C8Y6N0_BCL2L11      gttgcggcgtatcg-gagacgaatttaat--gcatattacccaaggagg-
A0A8C8Y6N0_BCL2L11      gttgcggcgtatcg-gagacgaatttaat--gcatattacccaaggagg-
A0A8C8Y6N0_BCL2L11      gttgcggcgtatcg-gagacgaatttaat--gcatattacccaaggaggg
A0A8C8Y6N0_BCL2L11      gttgcggcgtatcg-gagacgaatttaat--gcatattacccaaggaggg
                                                                          

A0A8C9D8E2_BIK-01       cttcctgac-------cctcaggaacagggtgtcccccaactccgggcgc
A0A8C9D8H0_PMAIP1-      ----cttatgaatctgata----------------tccaaactcttccgc
A0A8C8XJH6_HRK-01       -------gcggcgctggcg---------------------gcctggctgc
A0A8C8WWE4_BBC3-01      -gtacgagcggcggagaca-agaggagcagcagcgacaccgcccctcacc
A0A8C8XBT3_BAD-01       cgcccgaagagcgcgggcacagcgacgcagatgcggcaaagccc--cagc
A0A8C8WD49_BMF-01       ----ccagcaaaaccgccg------tcgagtgtggtggcagattctcctc
A0A8C8WD49_BMF-02       ----ccagcaaaaccgccg------tcgagtgtggtggcagattctcctc
A0A8C8Y6N0_BCL2L11      ----ctggcaagagtaccg-------------------------------
A0A8C8Y6N0_BCL2L11      ----ttagagcaatag----------------------------------
A0A8C8Y6N0_BCL2L11      tctttttgaataattaccaagcagccgaagcccagccccaaatgattatc
A0A8C8Y6N0_BCL2L11      tctttttgaataattaccaagcagccgaagcccagccccaaatgattatc
                                                                          

A0A8C9D8E2_BIK-01       ---gggctggcgctgtccctgctgctgctggtgttgctgctgggctgggg
A0A8C9D8H0_PMAIP1-      t--cg---------------------------------------------
A0A8C8XJH6_HRK-01       t--cggcagg----------------------------------------
A0A8C8WWE4_BBC3-01      c--tggagggtcctgtacaatctcatcatgggactcctgcccttacccag
A0A8C8XBT3_BAD-01       t--ggacgcgcttcatccagtcc--tggtgggat----------------
A0A8C8WD49_BMF-01       ttcctac---------acaacctggctttga-atgcagaagagaacagga
A0A8C8WD49_BMF-02       ttcctac---------acaacctggctttga-atgcagaagagaacagga
A0A8C8Y6N0_BCL2L11      ----------------gcatcctacatctga-------------------
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      ttacgactgttacgttacatcgtccgcctgatatggcgattgcagcga--
A0A8C8Y6N0_BCL2L11      ttacgactgttacgttacatcgtccgcctgatatggcgattgcagcga--
                                                                          

A0A8C9D8E2_BIK-01       gctccacctcctccagtga---------------------------
A0A8C9D8H0_PMAIP1-      -------ggaacctga------------------------------
A0A8C8XJH6_HRK-01       ------cggaacttg----------------------------tag
A0A8C8WWE4_BBC3-01      ggcccgcggggccccggagatggag------------cccaattag
A0A8C8XBT3_BAD-01       ------cggaacttggggagaggaggctccgccccctcccagtga-
A0A8C8WD49_BMF-01       atggggcaggtcccaggtga--------------------------
A0A8C8WD49_BMF-02       atggggcaggtcccaggtga--------------------------
A0A8C8Y6N0_BCL2L11      ----------------------------------------------
A0A8C8Y6N0_BCL2L11      ----------------------------------------------
A0A8C8Y6N0_BCL2L11      ----------------------------------------------
A0A8C8Y6N0_BCL2L11      ----------------------------------------------
                                                                      

© 1998-2022Legal notice