Dataset for CDS classical BH3-containing proteins of organism Pan troglodytes

[Download (right click)] [Alignment] [Repertoires]

12 sequence(s)

>gnl|bcl2dbcds|A0A2I3RGH5_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Pan troglodytes GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgccgcccccgccgcccccaccctgc
tgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctggggggtccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcc
cgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcag
cagcggcaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagc
ccccgagatggagcccaattag
>gnl|bcl2dbcds|A0A2I3RGH5_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Pan troglodytes GN=BBC3 (length=396 residues).
atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttccgcgacgtgggtcccctgcca
gatttgtggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggctctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagcggcaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgagatggagcccaattag
>gnl|bcl2dbcds|A0A2I3SN61_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaggctgaacctgcagatatgcgaccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2I3SN61_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A2I3SX38_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Pan troglodytes GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggctccagcagagctggaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|A0A2I3SX38_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Pan troglodytes GN=PMAIP1 (length=402 residues).
atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggctccagcaggaccggcgggtacggcgaggga
ccaagccggatttgggattgggatgcagctgcgtttcaccaggggcaaaaagctcctttcctcctctctttcctcctggc
cacttgcccttccccgggggcacgaggaacaagtgcaagtagctggaagtcgagtgtgctactcaactcaggagatttgg
agacaaactgaacttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaacctgactgcatcaaaaac
ttgcatgaggggactccttcaaaagagttttctcaggaggtgcacgtttcatcaatttgaagaaagactgcattgtaatt
gg
>gnl|bcl2dbcds|A0A2I3TBK7_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pan troglodytes GN=BAD (length=492 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagaacttcgtattctccttcttgggaatctgaggactctgaaaatcccagt
gcagggatgcttgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcccaacacgcagagaatgtaaa
gctagaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacggaggacgacgaagggatggg
ggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|A0A2I3TBK7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pan troglodytes GN=BAD (length=474 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagaagggacttcctcgcccgaagagcgcgggcacagcaacccagatgcggcaaag
ctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtgacctt
cgctccacatcccgaaactccacccgttcccactgccctgggcagccatcttgaatatgggcggaagtacttccctcagg
cctatgcaaaaagaggatccgtgctgtctcctttggagggagggctgaccccgattcccttccggtgcgtgtga
>gnl|bcl2dbcds|A0A2J8QDD5_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Pan troglodytes GN=BMF (length=390 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggggagccggtgacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaagctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatgcaccagcagaaccaaaatcgtgtgtggt
ggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcaggccctag
>gnl|bcl2dbcds|A0A2J8QDD5_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Pan troglodytes GN=BMF (length=555 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggggagccggtgacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaagctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctatcggcttcctctccc
tgccagtttcccagcagtcttgcccattggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccaaaatcgtgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcaggccctaggtga
>gnl|bcl2dbcds|H2Q6Y8_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Pan troglodytes GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcgaccccccggccgtgtgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccttggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|H2QLU7_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Pan troglodytes GN=BIK (length=483 residues).
atgtctgaagtaagacccctctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccccgaccat
ggaggttcttggcgtgactgactctgaagaggacctggaccctatggaggacttcgattctttggagtgcatggagggca
gtgacgcgttggccctgcggctggcctgcatcggggacgagatggacgtgagcctcagggccccacgcctggcccagctc
tccgacgtggccatgcacagcctgggtctggctttcatctacgaccagactgaggacatcagggatgttcttagaagttt
catggacggtttcaccacacttaaggagaacataatgaggttctggagatccccgaaccccgggtcctgggtgtcccgcg
aacaggtgctgctggcgctgctgctgctgctggcgctgctgctgccgctgctcagcgggggcctgcacctgctgctcaag
tga
© 1998-2020Legal notice