Dataset for CDS classical BH3-containing proteins of organism Pan troglodytes

[Download (right click)] [Edit] [Sequences] [Repertoires]

24 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I3SX38_PMAIP1-      atgc-----------------------ctgggaagaaggcgcgcaagaac
A0A2I3SX38_PMAIP1-      atgc-----------------------ctgggaagaaggcgcgcaagaac
H2QLU7_BIK-01           atg------------------------------------tctgaagtaag
A0A2I3TBK7_BAD-01       atgt----------tccagatcccagagtttgagccgagtgagcaggaag
A0A2I3TBK7_BAD-02       atgt----------tccagatcccagagtttgagccgagtgagcaggaag
A0A2I3TBK7_BAD-03       atgt----------tccagatcccagagtttgagccgagtgagcaggaag
H2Q6Y8_HRK-01           atg-----------------------------------------------
A0A2I3RGH5_BBC3-05      atg---------------------aaatttggcatggggtctgcccaggc
A0A2I3RGH5_BBC3-03      atg---------------------aaatttggcatggggtctgcccaggc
A0A2I3RGH5_BBC3-04      atg---------------------aaatttggcatggggtctgcccaggc
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      atg---------------------aaatttggcatggggtctgcccaggc
A0A2J8QDD5_BMF-01       atgg---agccatc-------------tcagtgtgtggaggagctggagg
A0A2J8QDD5_BMF-02       atgg---agccatc-------------tcagtgtgtggaggagctggagg
A0A2I3S5F6_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3S5F6_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3S5F6_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3S5F6_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3S5F6_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3S5F6_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3S5F6_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3S5F6_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3S5F6_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3S5F6_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
                                                                          

A0A2I3SX38_PMAIP1-      gc-----------------------------tcaaccgagccccg-----
A0A2I3SX38_PMAIP1-      gc-----------------------------tcaaccgagccccg-----
H2QLU7_BIK-01           ac------ccctctccagagacatcttgatggagaccc--tcctgtatga
A0A2I3TBK7_BAD-01       ac------tccagctctgcagagaggggcctgggccccagccccgcaggg
A0A2I3TBK7_BAD-02       ac------tccagctctgcagagaggggcctgggccccagccccgcaggg
A0A2I3TBK7_BAD-03       ac------tccagctctgcagagaggggcctgggccccagccccgcaggg
H2Q6Y8_HRK-01           -t------gcccgt-------------gcc-----ccctgcaccgc---g
A0A2I3RGH5_BBC3-05      at------gtccat-------------gccaggtgcccagggctgc---t
A0A2I3RGH5_BBC3-03      at------gtccat-------------gccaggtgcccagggctgc---t
A0A2I3RGH5_BBC3-04      at------gtccat-------------gccaggtgcccagggctgc---t
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      at------gtccat-------------gccaggtgcccagggctgc---t
A0A2J8QDD5_BMF-01       atgatgtgttccaaccagaggatggggagccggtgacccaacccg-----
A0A2J8QDD5_BMF-02       atgatgtgttccaaccagaggatggggagccggtgacccaacccg-----
A0A2I3S5F6_BCL2L11      acaa----ttgcagcctgcggagaggcctccccagctcagacctg-----
A0A2I3S5F6_BCL2L11      acaa----ttgcagcctgcggagaggcctccccagctcagacctg-----
A0A2I3S5F6_BCL2L11      acaa----ttgcagcctgcggagaggcctccccagctcagacctg-----
A0A2I3S5F6_BCL2L11      acaa----ttgcagcctgcggagaggcctccccagctcagacctg-----
A0A2I3S5F6_BCL2L11      acaa----ttgcagcctgcggagaggcctccccagctcagacctg-----
A0A2I3S5F6_BCL2L11      acaa----ttgcagcctgcggagaggcctccccagctcagacctg-----
A0A2I3S5F6_BCL2L11      acaa----ttgcagcctgcggagaggcctccccagctcagacctg-----
A0A2I3S5F6_BCL2L11      acaa----ttgcagcctgcggagaggcctccccagctcagacctg-----
A0A2I3S5F6_BCL2L11      acaa----ttgcagcctgcggagaggcctccccagctcagacctg-----
A0A2I3S5F6_BCL2L11      acaa----ttgcagcctgcggagaggcctccccagctcagacctg-----
                                                                          

A0A2I3SX38_PMAIP1-      --------cgcgggctccagcag---------------------------
A0A2I3SX38_PMAIP1-      --------cgcgggctccagcaggaccggcg-------------------
H2QLU7_BIK-01           gcagctcctggaacccccgaccatggaggttcttggcgtgactgactctg
A0A2I3TBK7_BAD-01       gacgggccctcaggctccggcaagcatcatc-------------------
A0A2I3TBK7_BAD-02       gacgggccctcaggctccggcaagcatcatc-------------------
A0A2I3TBK7_BAD-03       gacgggccctcaggctccggcaagcatcatc-------------------
H2Q6Y8_HRK-01           gccgcgac-----cccccggccg----tgtg-------------------
A0A2I3RGH5_BBC3-05      tccgcgacgtgggtcccctgccagatttgtg-------------------
A0A2I3RGH5_BBC3-03      tccgcgacgtgggtcccctgccagatttgtg-------------------
A0A2I3RGH5_BBC3-04      tccgcgacgtgggtcccctgccagatttgtggccccagggagcgccatgg
A0A2I3RGH5_BBC3-01      ----------------------------------------------atgg
A0A2I3RGH5_BBC3-02      tccgcgacgtgggtcccctgccagatttgtggccccagggagcgccatgg
A0A2J8QDD5_BMF-01       ---gga--gcttgctctctgctgacctgttt-------------------
A0A2J8QDD5_BMF-02       ---gga--gcttgctctctgctgacctgttt-------------------
A0A2I3S5F6_BCL2L11      ---gggcccctacctccctacaga--------------------------
A0A2I3S5F6_BCL2L11      ---gggcccctacctccctacaga--------------------------
A0A2I3S5F6_BCL2L11      ---gggcccctacctccctacaga--------------------------
A0A2I3S5F6_BCL2L11      ---gggcccctacctccctacaga--------------------------
A0A2I3S5F6_BCL2L11      ---gggcccctacctccctacaga--------------------------
A0A2I3S5F6_BCL2L11      ---gggcccctacctccctacaga--------------------------
A0A2I3S5F6_BCL2L11      ---gggcccctacctccctacaga--------------------------
A0A2I3S5F6_BCL2L11      ---gggcccctacctccctacaga--------------------------
A0A2I3S5F6_BCL2L11      ---gggcccctacctccctacaga--------------------------
A0A2I3S5F6_BCL2L11      ---gggcccctacctccctacaga--------------------------
                                                                          

A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      cccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcc
A0A2I3RGH5_BBC3-01      cccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcc
A0A2I3RGH5_BBC3-02      cccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcc
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
                                                                          

A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      cgcgacggcccgcgccccttcccgctcggccgcctggtgccctcggcagt
A0A2I3RGH5_BBC3-01      cgcgacggcccgcgccccttcccgctcggccgcctggtgccctcggcagt
A0A2I3RGH5_BBC3-02      cgcgacggcccgcgccccttcccgctcggccgcctggtgccctcggcagt
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
                                                                          

A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      gtcctgcggcctctgcgagcccggcctggctgccgcccccgccgccccca
A0A2I3RGH5_BBC3-01      gtcctgcggcctctgcgagcccggcctggctgccgcccccgccgccccca
A0A2I3RGH5_BBC3-02      gtcctgcggcctctgcgagcccggcctggctgccgcccccgccgccccca
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
                                                                          

A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      ccctgctgcccgctgcctacctctgcgcccccaccgccccacccgccgtc
A0A2I3RGH5_BBC3-01      ccctgctgcccgctgcctacctctgcgcccccaccgccccacccgccgtc
A0A2I3RGH5_BBC3-02      ccctgctgcccgctgcctacctctgcgcccccaccgccccacccgccgtc
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
                                                                          

A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      accgccgccctggggggtccccgctggcctgggggtccccgcagccggcc
A0A2I3RGH5_BBC3-01      accgccgccctggggggtccccgctggcctgggggtccccgcagccggcc
A0A2I3RGH5_BBC3-02      accgccgccctggggggtccccgctggcctgggggtccccgcagccggcc
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
                                                                          

A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      -------------------------------------------ggtacgg
H2QLU7_BIK-01           -------------------------------------------------a
A0A2I3TBK7_BAD-01       -------------------------------------------------g
A0A2I3TBK7_BAD-02       -------------------------------------------------g
A0A2I3TBK7_BAD-03       -------------------------------------------------g
H2Q6Y8_HRK-01           --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      -----------------------------------------------gtc
A0A2I3RGH5_BBC3-04      ccgaggcccgcgcccggacgggctggagactcggaggaactggagaagtc
A0A2I3RGH5_BBC3-01      ccgaggcccgcgcccggacg---------------------------gtc
A0A2I3RGH5_BBC3-02      ccgaggcccgcgcccggacg---------------------------gtc
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
                                                                          

A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      cgagggaccaagccggatttg-------------------ggattgggat
H2QLU7_BIK-01           agaggacctggaccctatgga--------------ggacttcgattcttt
A0A2I3TBK7_BAD-01       ccaggccccaggcctcctgtg--------------ggacgccagtcacca
A0A2I3TBK7_BAD-02       ccaggccccaggcctcctgtg--------------ggacgccagtcacca
A0A2I3TBK7_BAD-03       ccaggccccaggcctcctgtg--------------ggacgccagtcacca
H2Q6Y8_HRK-01           ---------------cgcctg--------------cagcgcgggtcgcct
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      ctcagccctcgctctcgctgg--------------cggagcag--cacct
A0A2I3RGH5_BBC3-04      ctcagccctcgctctcgctgg--------------cggagcag--cacct
A0A2I3RGH5_BBC3-01      ctcagccctcgctctcgctgg--------------cggagcag--cacct
A0A2I3RGH5_BBC3-02      ctcagccctcgctctcgctgg--------------cggagcag--cacct
A0A2J8QDD5_BMF-01       -----gcccagagcctactgg-----------------------------
A0A2J8QDD5_BMF-02       -----gcccagagcctactgg-----------------------------
A0A2I3S5F6_BCL2L11      --------cagagcc-acaag-----------------------------
A0A2I3S5F6_BCL2L11      --------cagagcc-acaag-----------------------------
A0A2I3S5F6_BCL2L11      --------cagagcc-acaag-----------------------------
A0A2I3S5F6_BCL2L11      --------cagagcc-acaaggtaatcctgaaggcaatcacggaggtgaa
A0A2I3S5F6_BCL2L11      --------cagagcc-acaaggtaatcctgaaggcaatcacggaggtgaa
A0A2I3S5F6_BCL2L11      --------cagagcc-acaaggtaatcctgaaggcaatcacggaggtgaa
A0A2I3S5F6_BCL2L11      --------cagagcc-aca-------------------------------
A0A2I3S5F6_BCL2L11      --------cagagcc-acaaggtaatcctgaaggcaatcacggaggtgaa
A0A2I3S5F6_BCL2L11      --------cagagcc-acaaggtaatcctgaaggcaatcacggaggtgaa
A0A2I3S5F6_BCL2L11      --------cagagcc-acaaggtaatcctgaaggcaatcacggaggtgaa
                                                                          

A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      gcagctgcgtttcaccaggggcaaaaagctcctttcctcctctctttcct
H2QLU7_BIK-01           ggagtgcatggagggcagtgacgcgttggccct-----------------
A0A2I3TBK7_BAD-01       gcaggagcagccaaccagca------------------------------
A0A2I3TBK7_BAD-02       gcaggagcagccaaccagca------------------------------
A0A2I3TBK7_BAD-03       gcaggagcagccaaccagca------------------------------
H2Q6Y8_HRK-01           ggggctgcgctcgtccgccgc-----------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      ggagtcgcccgtgcccagcgccccgggggctctggcgggcggtcccaccc
A0A2I3RGH5_BBC3-04      ggagtcgcccgtgcccagcgccccgggggctctggcgggcggtcccaccc
A0A2I3RGH5_BBC3-01      ggagtcgcccgtgcccagcgccccgggggctctggcgggcggtcccaccc
A0A2I3RGH5_BBC3-02      ggagtcgcccgtgcccagcgccccgggggctctggcgggcggtcccaccc
A0A2J8QDD5_BMF-01       -------actgccccctcagccgacttcagctcttccctctcacccactg
A0A2J8QDD5_BMF-02       -------actgccccctcagccgacttcagctcttccctctcacccactg
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      ggggacagctgcccccacggcagccctcag---ggcccgctggccccacc
A0A2I3S5F6_BCL2L11      ggggacagctgcccccacggcagccctcag---ggcccgctggccccacc
A0A2I3S5F6_BCL2L11      ggggacagctgcccccacggcagccctcag---ggcccgctggccccacc
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      ggggacagctgcccccacggcagccctcag---ggcccgctggccccacc
A0A2I3S5F6_BCL2L11      ggggacagctgcccccacggcagccctcag---ggcccgctggccccacc
A0A2I3S5F6_BCL2L11      ggggacagctgcccccacggcagccctcag---ggcccgctggccccacc
                                                                          

A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      cctggccacttgcccttccccgggggcacgagg-----------------
H2QLU7_BIK-01           --gcggctg-----gcctgcatcggggacga-------------------
A0A2I3TBK7_BAD-01       --gcagcca---------tcatggagaagggacttcctcgccc-------
A0A2I3TBK7_BAD-02       --gcagcca---------tcatg---------------------------
A0A2I3TBK7_BAD-03       --gcagcca---------tcatggagggagaacttcgtattctccttctt
H2Q6Y8_HRK-01           --gcagctc-----------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      aggcggccccgggagtccgcggggaggaggaac-----------------
A0A2I3RGH5_BBC3-04      aggcggccccgggagtccgcggggaggaggaac-----------------
A0A2I3RGH5_BBC3-01      aggcggccccgggagtccgcggggaggaggaac-----------------
A0A2I3RGH5_BBC3-02      aggcggccccgggagtccgcggggaggaggaac-----------------
A0A2J8QDD5_BMF-01       ctgtggccctggccttc---------------------------------
A0A2J8QDD5_BMF-02       ctgtggccctggccttc---------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2I3S5F6_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2I3S5F6_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2I3S5F6_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2I3S5F6_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
                                                                          

A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I3TBK7_BAD-03       gggaatctgaggactctgaaaatcccagtgcagggatgcttgcggaagca
H2Q6Y8_HRK-01           --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2I3S5F6_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2I3S5F6_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2I3S5F6_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2I3S5F6_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
                                                                          

A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I3TBK7_BAD-03       tcagcagggatgtccgccccagccgctgactcagaagcccaacacgcaga
H2Q6Y8_HRK-01           --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      acag----------------------------------------------
A0A2I3S5F6_BCL2L11      acag----------------------------------------------
A0A2I3S5F6_BCL2L11      acag----------------------------------------------
A0A2I3S5F6_BCL2L11      --ag----------------------------------------------
A0A2I3S5F6_BCL2L11      acag----------------------------------------------
A0A2I3S5F6_BCL2L11      acag----------------------------------------------
A0A2I3S5F6_BCL2L11      acag----------------------------------------------
                                                                          

A0A2I3SX38_PMAIP1-      --------------------------agctggaagtcgagt----gtgct
A0A2I3SX38_PMAIP1-      -------------aacaagtgcaagtagctggaagtcgagt----gtgct
H2QLU7_BIK-01           -------------gatggacgtgagcctcagggcccc--------acgcc
A0A2I3TBK7_BAD-01       -------------gaagagcgcgggc-acagcaacccagat----gcggc
A0A2I3TBK7_BAD-02       -------------gaggcgctggggctgtggagatccggag----tcgcc
A0A2I3TBK7_BAD-03       gaatgtaaagctagaggcgctggggctgtggagatccggag----tcgcc
H2Q6Y8_HRK-01           ---------------------------accgccgcccggctcaaggcgct
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      -------------agtgggcccgggagatcggggcccagct----gcggc
A0A2I3RGH5_BBC3-04      -------------agtgggcccgggagatcggggcccagct----gcggc
A0A2I3RGH5_BBC3-01      -------------agtgggcccgggagatcggggcccagct----gcggc
A0A2I3RGH5_BBC3-02      -------------agtgggcccgggagatcggggcccagct----gcggc
A0A2J8QDD5_BMF-01       --------------------------------gaccca-------ccagc
A0A2J8QDD5_BMF-02       --------------------------------gaccca-------ccagc
A0A2I3S5F6_BCL2L11      ---------------------------acaggagccca-------gcacc
A0A2I3S5F6_BCL2L11      ---------------------------acaggagccca-------gcacc
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      ---------------------------acaggagccca-------gcacc
A0A2I3S5F6_BCL2L11      ---------------------------acaggagccca-------gcacc
A0A2I3S5F6_BCL2L11      ---------------------------acaggagccca-------gcacc
A0A2I3S5F6_BCL2L11      ---------------------------acaggagccca-------gcacc
A0A2I3S5F6_BCL2L11      ---------------------------acaggagccca-------gcacc
A0A2I3S5F6_BCL2L11      ---------------------------acaggagccca-------gcacc
A0A2I3S5F6_BCL2L11      ---------------------------acaggagccca-------gcacc
                                                                          

A0A2I3SX38_PMAIP1-      actcaactca----------------------------------------
A0A2I3SX38_PMAIP1-      actcaactca----------------------------------------
H2QLU7_BIK-01           tggcccagctctccgacgtggccatgcacagcctgggtctggctttcatc
A0A2I3TBK7_BAD-01       aaagctccagct------ggacgcgagtcttccagtcctgg---------
A0A2I3TBK7_BAD-02       acagctcctaccccgcggggacggaggacgac-------ga---------
A0A2I3TBK7_BAD-03       acagctcctaccccgcggggacggaggacgac-------ga---------
H2Q6Y8_HRK-01           aggcgacgagctgcaccagcgcaccatgtg-gcggcgccg----------
A0A2I3RGH5_BBC3-05      --------------------------------------aga---------
A0A2I3RGH5_BBC3-03      ggatggcggacgacctcaacgcgcagtacgagcggcggaga---------
A0A2I3RGH5_BBC3-04      ggatggcggacgacctcaacgcgcagtacgagcggcggaga---------
A0A2I3RGH5_BBC3-01      ggatggcggacgacctcaacgcgcagtacgagcggcggaga---------
A0A2I3RGH5_BBC3-02      ggatggcggacgacctcaacgcgcagtacgagcggcggaga---------
A0A2J8QDD5_BMF-01       ca------------------------------------------------
A0A2J8QDD5_BMF-02       ca------------------------------------------------
A0A2I3S5F6_BCL2L11      ca------------------------------------------------
A0A2I3S5F6_BCL2L11      ca------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      ca------------------------------------------------
A0A2I3S5F6_BCL2L11      ca------------------------------------------------
A0A2I3S5F6_BCL2L11      ca------------------------------------------------
A0A2I3S5F6_BCL2L11      ca------------------------------------------------
A0A2I3S5F6_BCL2L11      ca------------------------------------------------
A0A2I3S5F6_BCL2L11      ca------------------------------------------------
A0A2I3S5F6_BCL2L11      ca------------------------------------------------
                                                                          

A0A2I3SX38_PMAIP1-      ggagatttg---gagacaaactgaacttccggcagaaacttctgaatctg
A0A2I3SX38_PMAIP1-      ggagatttg---gagacaaactgaacttccggcagaaacttctgaatctg
H2QLU7_BIK-01           tacgaccag--------actgaggacatcagggatgttcttagaagtttc
A0A2I3TBK7_BAD-01       tgggatcggaacttgggcaggggaagctccgccccct-cc-cagtgacct
A0A2I3TBK7_BAD-02       agggatggg----------ggaggagcccagcccctt-tcggggccgctc
A0A2I3TBK7_BAD-03       agggatggg----------ggaggagcccagcccctt-tcggggccgctc
H2Q6Y8_HRK-01           cgcgcggag--------ccggag-ggcgccggcgcccggcgcg-------
A0A2I3RGH5_BBC3-05      caagaggag--------cagcagcggcaccgcccctcgccctggagggtc
A0A2I3RGH5_BBC3-03      caagaggag--------cagcagcggcaccgcccctcgccctggagggtc
A0A2I3RGH5_BBC3-04      caagaggag--------cagcagcggcaccgcccctcgccctggagggtc
A0A2I3RGH5_BBC3-01      caagaggag--------cagcagcggcaccgcccctcgccctggagggtc
A0A2I3RGH5_BBC3-02      caagaggag--------cagcagcggcaccgcccctcgccctggagggtc
A0A2J8QDD5_BMF-01       ggaa----gacaaagctacccagaccctcagcccagcct------ccccc
A0A2J8QDD5_BMF-02       ggaa----gacaaagctacccagaccctcagcccagcct------ccccc
A0A2I3S5F6_BCL2L11      tgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttc
A0A2I3S5F6_BCL2L11      tgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttc
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      tgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttc
A0A2I3S5F6_BCL2L11      tgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttc
A0A2I3S5F6_BCL2L11      tgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttc
A0A2I3S5F6_BCL2L11      tgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttc
A0A2I3S5F6_BCL2L11      tgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttc
A0A2I3S5F6_BCL2L11      tgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttc
A0A2I3S5F6_BCL2L11      tgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttc
                                                                          

A0A2I3SX38_PMAIP1-      atatccaaactcttc------------------tgctcaggaacctga--
A0A2I3SX38_PMAIP1-      atatccaaactcttc------------------tgctcaggaacctgact
H2QLU7_BIK-01           atggacggtttcaccacac-----------------ttaaggagaacata
A0A2I3TBK7_BAD-01       tcgctccacatcccgaaactccacccgttcccactgccctgggcagc-ca
A0A2I3TBK7_BAD-02       gcgctcggcgccccccaac-----------------ctctgggcagcaca
A0A2I3TBK7_BAD-03       gcgctcggcgccccccaac-----------------ctctgggcagcaca
H2Q6Y8_HRK-01           ---------ctcccc--ac----ctactggccttggctgtgcgcggccgc
A0A2I3RGH5_BBC3-05      ctgtacaatctcatc--atgggactcctgcccttacccaggggccacaga
A0A2I3RGH5_BBC3-03      ctgtacaatctcatc--atgggactcctgcccttacccaggggccacaga
A0A2I3RGH5_BBC3-04      ctgtacaatctcatc--atgggactcctgcccttacccaggggccacaga
A0A2I3RGH5_BBC3-01      ctgtacaatctcatc--atgggactcctgcccttacccaggggccacaga
A0A2I3RGH5_BBC3-02      ctgtacaatctcatc--atgggactcctgcccttacccaggggccacaga
A0A2J8QDD5_BMF-01       agccaaggtgtcatgctgc------------------cttgtggggtgac
A0A2J8QDD5_BMF-02       agccaaggtgtcatgctgc------------------cttgtggggtgac
A0A2I3S5F6_BCL2L11      aaccactatctca---------------------------gtgcaatggt
A0A2I3S5F6_BCL2L11      aaccactatctca---------------------------gtgcaatgg-
A0A2I3S5F6_BCL2L11      -------------------------------------------------c
A0A2I3S5F6_BCL2L11      aaccactatctca---------------------------gtgcaatggt
A0A2I3S5F6_BCL2L11      aaccactatctca---------------------------gtgcaat---
A0A2I3S5F6_BCL2L11      aaccactatctca---------------------------gtgcaatggc
A0A2I3S5F6_BCL2L11      aaccactatctca---------------------------gtgcaatggc
A0A2I3S5F6_BCL2L11      aaccactatctca---------------------------gtgcaatggc
A0A2I3S5F6_BCL2L11      aaccactatctca---------------------------gtgcaatggc
A0A2I3S5F6_BCL2L11      aaccactatctca---------------------------gtgcaatggc
                                                                          

A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      gcatcaaaaacttgcatgaggggactccttcaa-----------------
H2QLU7_BIK-01           at----gaggttctggagatccccgaaccccgg-----------------
A0A2I3TBK7_BAD-01       tc-ttgaatatgggcggaagtacttccctcagg-----------------
A0A2I3TBK7_BAD-02       gc----gctatggccgcgag-------ctccgg-----------------
A0A2I3TBK7_BAD-03       gc----gctatggccgcgag-------ctccgg-----------------
H2Q6Y8_HRK-01           gc-----aggtggcggc--g--------ctggc-----------------
A0A2I3RGH5_BBC3-05      gcccccgagatggagcccaa--------ttagg-----------------
A0A2I3RGH5_BBC3-03      gcccccgagatggagcccaa--------ttag------------------
A0A2I3RGH5_BBC3-04      gcccccgagatggagcccaa--------ttagg-----------------
A0A2I3RGH5_BBC3-01      gcccccgagatggagcccaa--------ttag------------------
A0A2I3RGH5_BBC3-02      gcccccgagatggagcccaa--------ttagg-----------------
A0A2J8QDD5_BMF-01       t-------gaggaaccccagcgactcttttatg-----------------
A0A2J8QDD5_BMF-02       t-------gaggaaccccagcgactcttttatggcaatgctggctatcgg
A0A2I3S5F6_BCL2L11      agtcatcctagaggatataggtgatctttcact-----------------
A0A2I3S5F6_BCL2L11      ----at------gactccgctggatcct----------------------
A0A2I3S5F6_BCL2L11      ttccat------gaggcaggctgaacctgcaga-----------------
A0A2I3S5F6_BCL2L11      t-------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      ttccat------gaggcaggctgaacctgcaga-----------------
A0A2I3S5F6_BCL2L11      ttccat------gaggcaggctgaacctgcaga-----------------
A0A2I3S5F6_BCL2L11      ttccat------gaggcaggctgaacctgcaga-----------------
A0A2I3S5F6_BCL2L11      ttccat------gaggcaggctgaacctgcaga-----------------
A0A2I3S5F6_BCL2L11      t-------------------------------------------------
                                                                          

A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       cttcctctccctgccagtttcccagcagtcttgcccattggggagcagcc
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
                                                                          

A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
H2QLU7_BIK-01           --------------------gtcctgggtgtcccgcgaacaggtgctgct
A0A2I3TBK7_BAD-01       --------------------cctatgcaaaaagaggatccgtgctgtctc
A0A2I3TBK7_BAD-02       --------------------aggatgagtgacgag----tttgtggactc
A0A2I3TBK7_BAD-03       --------------------aggatga-----------------------
H2Q6Y8_HRK-01           --------------------ggcctg------------------------
A0A2I3RGH5_BBC3-05      --------------------tgcctgcacccgcccggtggacgtcaggga
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      --------------------tgcctgcacccgcccggtggacgtcaggga
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      --------------------tgcctgcacccgcccggtggacgtcaggga
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       ccccgaagggcagtggcaacatcgagcagaggtacagattgcccgaaagc
A0A2I3S5F6_BCL2L11      ------------------gtgctttggatttatatttactggcttagatt
A0A2I3S5F6_BCL2L11      ----------------------------------------ccctcagaat
A0A2I3S5F6_BCL2L11      ------------------tatgcgaccggagatatggatcgcccaagagt
A0A2I3S5F6_BCL2L11      ---------------------------agagaaatag-------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      ------------------tatgcgaccggagatatggatcgcccaagagt
A0A2I3S5F6_BCL2L11      ------------------tatgcgaccggagatatggatcgcccaagagt
A0A2I3S5F6_BCL2L11      ------------------tatgcgaccggagatatggatcgcccaagagt
A0A2I3S5F6_BCL2L11      ------------------tatgcgaccggagatatggatcgcccaagagt
A0A2I3S5F6_BCL2L11      -----------------------aactgg---------------------
                                                                          

A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
H2QLU7_BIK-01           ggcgctgctgctgctgctggcgctgct-----------------------
A0A2I3TBK7_BAD-01       ctttggagggag--------------------------------------
A0A2I3TBK7_BAD-02       ctttaagaagggacttcctcgcccgaagagcgcgggcacagcaacccaga
A0A2I3TBK7_BAD-03       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
A0A2I3RGH5_BBC3-05      ctcggggggcaggcccctcccacctcctgaca------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      ctcggggggcaggcccctcccacctcctgaca------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      ctcggggggcaggcccctcccacctcctgaca------------------
A0A2J8QDD5_BMF-01       --------------------------------------------caccag
A0A2J8QDD5_BMF-02       ttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccag
A0A2I3S5F6_BCL2L11      tgtatggc------------------------------------caccac
A0A2I3S5F6_BCL2L11      tgccctt----------------------------------------cat
A0A2I3S5F6_BCL2L11      tgcggcg----------------------------------------tat
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      tgcggcg----------------------------------------tat
A0A2I3S5F6_BCL2L11      tgcggcg----------------------------------------tat
A0A2I3S5F6_BCL2L11      tgcggcg----------------------------------------tat
A0A2I3S5F6_BCL2L11      tgcggcg----------------------------------------tat
A0A2I3S5F6_BCL2L11      --------------------------------------------------
                                                                          

A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------aagagt
H2QLU7_BIK-01           ---------gctgccgctgctc----------------------------
A0A2I3TBK7_BAD-01       --------------ggctgaccccgattc---------------------
A0A2I3TBK7_BAD-02       tgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcgg
A0A2I3TBK7_BAD-03       --------------------------------------------------
H2Q6Y8_HRK-01           ---------------gctgctc----------------------------
A0A2I3RGH5_BBC3-05      --------------ccctggcc----------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      --------------ccctggcc----------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      --------------ccctggcc----------------------------
A0A2J8QDD5_BMF-01       cagaaccaaaatcgtgtgtggtggcagatcctcctcttcctgcacaacct
A0A2J8QDD5_BMF-02       cagaaccaaaatcgtgtgtggtggcagatcctcctcttcctgcacaacct
A0A2I3S5F6_BCL2L11      catagtcaagatgc-------------------------------agaac
A0A2I3S5F6_BCL2L11      aggg---aagttca-------------------------------gtggc
A0A2I3S5F6_BCL2L11      cggagacgagttta-------------------------------acgct
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      cggagacgagttta-------------------------------acgct
A0A2I3S5F6_BCL2L11      cggagacgagttta-------------------------------acgct
A0A2I3S5F6_BCL2L11      cggagacgagttta-------------------------------acgct
A0A2I3S5F6_BCL2L11      cggagacgagttta-------------------------------acgct
A0A2I3S5F6_BCL2L11      --------------------------------------------------
                                                                          

A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      tttctcaggaggtgcacgtttcatcaatttgaagaaagactgcattgtaa
H2QLU7_BIK-01           ------agcgggggcctgcacctgctgctcaagtga--------------
A0A2I3TBK7_BAD-01       -------------------ccttccggtgcgtgtga--------------
A0A2I3TBK7_BAD-02       aacttgggcaggggaagctccgccccctcccagtga--------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
H2Q6Y8_HRK-01           ------ggcaggcggaact------------tgtag--------------
A0A2I3RGH5_BBC3-05      ------agcgcgggggactttctctgcaccatgtag--------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      ------agcgcgggggactttctctgcaccatgtag--------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      ------agcgcgggggactttctctgcaccatgtag--------------
A0A2J8QDD5_BMF-01       tgctttgaatggagaaga------------gaacag--------------
A0A2J8QDD5_BMF-02       tgctttgaatggagaaga------------gaacag--------------
A0A2I3S5F6_BCL2L11      aactcaaccacaaggatttc----------tcatga--------------
A0A2I3S5F6_BCL2L11      cactc----aagtggtta------------gcaaaa--------------
A0A2I3S5F6_BCL2L11      tactatgcaaggaggctg------------gcaaaa--------------
A0A2I3S5F6_BCL2L11      ---------aggaagttgtc----------gtgtag--------------
A0A2I3S5F6_BCL2L11      -------------gggtattttt-------gaataa--------------
A0A2I3S5F6_BCL2L11      tactatgcaaggagggtattttt-------gaataattaccaagcagccg
A0A2I3S5F6_BCL2L11      tactatgcaaggagggtattttt-------gaataattaccaagcagccg
A0A2I3S5F6_BCL2L11      tactatgcaaggaggatgcctcttccacctgattaa--------------
A0A2I3S5F6_BCL2L11      tactatgcaaggaggtt---------agagaaatag--------------
A0A2I3S5F6_BCL2L11      ------------------------------gactag--------------
                                                                          

A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      ttgg----------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------gaacggggcaggccctag
A0A2J8QDD5_BMF-02       --------------------------------gaacggggcaggccctag
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      ---------------------------------------------tcaag
A0A2I3S5F6_BCL2L11      ---------------------------------ctcctggcatcctccac
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      aagaccacccacgaatggttatcttacgactgttacgttacattgtccgc
A0A2I3S5F6_BCL2L11      aagaccacccacgaatggttatcttacgactgttacgttacattgtccgc
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
A0A2I3S5F6_BCL2L11      --------------------------------------------------
                                                                          

A0A2I3SX38_PMAIP1-      ---------------------
A0A2I3SX38_PMAIP1-      ---------------------
H2QLU7_BIK-01           ---------------------
A0A2I3TBK7_BAD-01       ---------------------
A0A2I3TBK7_BAD-02       ---------------------
A0A2I3TBK7_BAD-03       ---------------------
H2Q6Y8_HRK-01           ---------------------
A0A2I3RGH5_BBC3-05      ---------------------
A0A2I3RGH5_BBC3-03      ---------------------
A0A2I3RGH5_BBC3-04      ---------------------
A0A2I3RGH5_BBC3-01      ---------------------
A0A2I3RGH5_BBC3-02      ---------------------
A0A2J8QDD5_BMF-01       ---------------------
A0A2J8QDD5_BMF-02       gtga-----------------
A0A2I3S5F6_BCL2L11      ---------------------
A0A2I3S5F6_BCL2L11      ctaa-----------------
A0A2I3S5F6_BCL2L11      ctga-----------------
A0A2I3S5F6_BCL2L11      ---------------------
A0A2I3S5F6_BCL2L11      ---------------------
A0A2I3S5F6_BCL2L11      ctggtgtggagaatgcattga
A0A2I3S5F6_BCL2L11      ctggtgtggagaatgcattga
A0A2I3S5F6_BCL2L11      ---------------------
A0A2I3S5F6_BCL2L11      ---------------------
A0A2I3S5F6_BCL2L11      ---------------------
                                             

© 1998-2022Legal notice