Dataset for CDS classical BH3-containing proteins of organism Pan troglodytes

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

H2QLU7_BIK-01           atg--------tctgaagtaagacccctctccagagacatcttgatggag
A0A2I3SX38_PMAIP1-      atg-----------------------------------------------
A0A2I3SX38_PMAIP1-      atg-----------------------------------------------
A0A2I3SN61_BCL2L11      atg--------------gcaaagcaaccttctgatg--------------
A0A2I3SN61_BCL2L11      atg--------------gcaaagcaaccttctgatg--------------
H2Q6Y8_HRK-01           atg-----------------------------------------------
A0A2I3RGH5_BBC3-03      atg-----------------------------aaat--------------
A0A2I3RIG5_BBC3-02      atggcccgcgcacgccaggagggcagctccccggag--------------
A0A2J8QDD5_BMF-01       atg------------------gagcc-atctcagtg--------------
A0A2J8QDD5_BMF-02       atg------------------gagcc-atctcagtg--------------
A0A2I3TBK7_BAD-03       atg------------------ttccagatcccagag--------------
A0A2I3TBK7_BAD-01       atg------------------ttccagatcccagag--------------

H2QLU7_BIK-01           accctcctgtatgagcagctcctggaacccccgaccatggaggttcttgg
A0A2I3SX38_PMAIP1-      ---------------------------------------------cctgg
A0A2I3SX38_PMAIP1-      ---------------------------------------------cctgg
A0A2I3SN61_BCL2L11      ---------------------------------------------taagt
A0A2I3SN61_BCL2L11      ---------------------------------------------taagt
H2Q6Y8_HRK-01           --------------------------------------------------
A0A2I3RGH5_BBC3-03      ---------------------------------------------ttggc
A0A2I3RIG5_BBC3-02      ---------------------------------------------cccgt
A0A2J8QDD5_BMF-01       ---------------------------------------------tgtg-
A0A2J8QDD5_BMF-02       ---------------------------------------------tgtg-
A0A2I3TBK7_BAD-03       ---------------------------------------------tttga
A0A2I3TBK7_BAD-01       ---------------------------------------------tttga

H2QLU7_BIK-01           cgtgactgactctgaagaggacctggaccctatggaggacttcgattctt
A0A2I3SX38_PMAIP1-      gaagaaggcgcgcaagaacgctc---------------------------
A0A2I3SX38_PMAIP1-      gaagaaggcgcgcaagaacgctc---------------------------
A0A2I3SN61_BCL2L11      tctgagtgtgaccgagaaggtag----acaattgcagc-ctgcg------
A0A2I3SN61_BCL2L11      tctgagtgtgaccgagaaggtag----acaattgcagc-ctgcg------
H2Q6Y8_HRK-01           --------tgccc----gtgccc----------cctgcaccgcg------
A0A2I3RGH5_BBC3-03      atggggtctgcccaggcatgtcc-------------------at------
A0A2I3RIG5_BBC3-02      agagggcctggcccgcgacggcccgcgccccttcccgctcggcc------
A0A2J8QDD5_BMF-01       ---gag-gagctggaggatgatg------tgttccaaccagagg------
A0A2J8QDD5_BMF-02       ---gag-gagctggaggatgatg------tgttccaaccagagg------
A0A2I3TBK7_BAD-03       gccgagtgagcaggaaga-------------ctccagctctgca------
A0A2I3TBK7_BAD-01       gccgagtgagcaggaaga-------------ctccagctctgca------

H2QLU7_BIK-01           tggagtgcatggagggcagtgacgcgttggccctgcggctggcctg----
A0A2I3SX38_PMAIP1-      -----------------------aaccgagccccg---------------
A0A2I3SX38_PMAIP1-      -----------------------aaccgagccccg---------------
A0A2I3SN61_BCL2L11      ----------gagaggcctccccagctcagacctg---------------
A0A2I3SN61_BCL2L11      ----------gagaggcctccccagctcagacctg---------------
H2Q6Y8_HRK-01           ----------gccgcgaccccccggccgtgt------gcgcctgcag---
A0A2I3RGH5_BBC3-03      ----------gccaggtgcccagg----------gctgcttccgcga---
A0A2I3RIG5_BBC3-02      ----------gcctggtgccctcggcagtgtcctgcggcctctgcgagcc
A0A2J8QDD5_BMF-01       ----------atggggagccggtgacccaacccgggagcttgctctctgc
A0A2J8QDD5_BMF-02       ----------atggggagccggtgacccaacccgggagcttgctctctgc
A0A2I3TBK7_BAD-03       ----------gagaggggcctgggccccagccccgcag------------
A0A2I3TBK7_BAD-01       ----------gagaggggcctgggccccagccccgcag------------

H2QLU7_BIK-01           --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RIG5_BBC3-02      cggcctggctgccgcccccgccgcccccaccctgctgcccgctgcctacc
A0A2J8QDD5_BMF-01       tgacctgtt-----------------------------------------
A0A2J8QDD5_BMF-02       tgacctgtt-----------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------

H2QLU7_BIK-01           ---------------------------------------catcggggacg
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
H2Q6Y8_HRK-01           ---------------------------------------cgcgggtcgcc
A0A2I3RGH5_BBC3-03      ---------------------------------------cgtgggtcccc
A0A2I3RIG5_BBC3-02      tctgcgcccccaccgccccacccgccgtcaccgccgccctggggggtccc
A0A2J8QDD5_BMF-01       ---------------------------------------tgcccagagcc
A0A2J8QDD5_BMF-02       ---------------------------------------tgcccagagcc
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------

H2QLU7_BIK-01           agatggacg--------------------------------------tga
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SN61_BCL2L11      -----------------------------------------------ggg
A0A2I3SN61_BCL2L11      -----------------------------------------------ggg
H2Q6Y8_HRK-01           tg--gggct-----------------------------------------
A0A2I3RGH5_BBC3-03      tgccagatttg------------------------------------tgg
A0A2I3RIG5_BBC3-02      cgctggcctgggggtccccgcagccggccccgaggcccgcgcccggacgg
A0A2J8QDD5_BMF-01       tactggact--------------------------------------gcc
A0A2J8QDD5_BMF-02       tactggact--------------------------------------gcc
A0A2I3TBK7_BAD-03       ----gggac--------------------------------------ggg
A0A2I3TBK7_BAD-01       ----gggac--------------------------------------ggg

H2QLU7_BIK-01           gcctcag-----ggccccacgcctggcccagctctccgacgtggccatgc
A0A2I3SX38_PMAIP1-      --cgcgg-----gctccagcag----------------------------
A0A2I3SX38_PMAIP1-      --cgcgg-----gctccagcaggaccggcgggt-----------------
A0A2I3SN61_BCL2L11      cccctac-----ctccctacagacaga-----------------------
A0A2I3SN61_BCL2L11      cccctac-----ctccctacagacaga-----------------------
H2Q6Y8_HRK-01           ------------gcgctcgtccgccgcgcagctc---------acc----
A0A2I3RGH5_BBC3-03      tcctcagccctcgctctcgctggcggagcag--c---------acctgga
A0A2I3RIG5_BBC3-02      tcctcagccctcgctctcgctggcggagcag--c---------acctgga
A0A2J8QDD5_BMF-01       ccctcag-----ccgacttcagctcttccctctc---------accc---
A0A2J8QDD5_BMF-02       ccctcag-----ccgacttcagctcttccctctc---------accc---
A0A2I3TBK7_BAD-03       ccctcag-----gctccggcaagcat--------------------c---
A0A2I3TBK7_BAD-01       ccctcag-----gctccggcaagcat--------------------c---

H2QLU7_BIK-01           acagcctgggtctggctttcatctacgaccagact---------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      acggcgagggaccaagccggatttgggattgggatgcagctgcgtttcac
A0A2I3SN61_BCL2L11      gccacaag------gtaatcctgaaggc-------------------aat
A0A2I3SN61_BCL2L11      gccacaag------gtaatcctgaaggc-------------------aat
H2Q6Y8_HRK-01           gccgcccg-gctcaaggcgct---agg-----------------------
A0A2I3RGH5_BBC3-03      gtcgcccgtgcccagcgcccc---gggg-------------------gct
A0A2I3RIG5_BBC3-02      gtcgcccgtgcccagcgcccc---gggg-------------------gct
A0A2J8QDD5_BMF-01       actgctgtggccctggccttc---gacc-------------------cac
A0A2J8QDD5_BMF-02       actgctgtggccctggccttc---gacc-------------------cac
A0A2I3TBK7_BAD-03       atcgccaggccccaggcctcctgtggga-------------------cgc
A0A2I3TBK7_BAD-01       atcgccaggccccaggcctcctgtggga-------------------cgc

H2QLU7_BIK-01           ---gaggacatcagggatgttcttagaagtttcatggacggtttcaccac
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      ca-ggggcaaaaagctcctttcctcctctctttcctcctggccac-ttgc
A0A2I3SN61_BCL2L11      cacggaggtgaaggggacagctgccc---------ccacggcagc-cctc
A0A2I3SN61_BCL2L11      cacggaggtgaaggggacagctgccc---------ccacggcagc-cctc
H2Q6Y8_HRK-01           -c-gacg--agctgcaccagcgcaccatgtggcggcgccg-------cgc
A0A2I3RGH5_BBC3-03      ct-ggcg--ggcggtccca----ccca---ggcggccccgggagt-ccgc
A0A2I3RIG5_BBC3-02      ct-ggcg--ggcggtccca----ccca---ggcggccccgggagt-ccgc
A0A2J8QDD5_BMF-01       ca-gcca--ggaagacaaagctacccagaccctcagcccagcctc-cccc
A0A2J8QDD5_BMF-02       ca-gcca--ggaagacaaagctacccagaccctcagcccagcctc-cccc
A0A2I3TBK7_BAD-03       ca-gtcaccagcaggagcagccaaccag----------cagcagc-catc
A0A2I3TBK7_BAD-01       ca-gtcaccagcaggagcagccaaccag----------cagcagc-catc

H2QLU7_BIK-01           acttaaggagaacata-----------atgaggttctggagatcc-----
A0A2I3SX38_PMAIP1-      ---------------------------------agctggaagtcgagtgt
A0A2I3SX38_PMAIP1-      ccttccccgggggcacgaggaacaagtgcaagtagctggaagtcgagtgt
A0A2I3SN61_BCL2L11      a-------gggcccgc--------------tggccccaccgg--------
A0A2I3SN61_BCL2L11      a-------gggcccgc--------------tggccccaccgg--------
H2Q6Y8_HRK-01           gcggagccgga-------------------gggcgccggcgcccg-gcgc
A0A2I3RGH5_BBC3-03      ggggaggaggaacagt--------------gggcccgggagatcg-ggg-
A0A2I3RIG5_BBC3-02      ggggaggaggaacagt--------------gggcccgggagatcg-ggg-
A0A2J8QDD5_BMF-01       agccaaggtgtcatgc-----tgccttgtggggtgactgagga-------
A0A2J8QDD5_BMF-02       agccaaggtgtcatgc-----tgccttgtggggtgactgagga-------
A0A2I3TBK7_BAD-03       atggagggagaacttcgtattctccttcttgggaatctgaggact-ctga
A0A2I3TBK7_BAD-01       atggagaagggacttc-----ctc----------gcccgaagagc-gcgg

H2QLU7_BIK-01           ----ccgaaccccgggtcctgggtgtcccgcga-----------------
A0A2I3SX38_PMAIP1-      gctactcaactcaggagatttggagacaaactg-----------------
A0A2I3SX38_PMAIP1-      gctactcaactcaggagatttggagacaaactg-----------------
A0A2I3SN61_BCL2L11      -----ccagccctggcccttttgctacca---------------------
A0A2I3SN61_BCL2L11      -----ccagccctggcccttttgctacca---------------------
H2Q6Y8_HRK-01           gctccccacc-----------tac--------------------------
A0A2I3RGH5_BBC3-03      ----cccagc-----------tgcggcggatgg-----------------
A0A2I3RIG5_BBC3-02      ----cccagc-----------tgcggcggatgg-----------------
A0A2J8QDD5_BMF-01       --accccagc---gactcttttatg-------------------------
A0A2J8QDD5_BMF-02       --accccagc---gactcttttatggcaatgctggctatcggcttcctct
A0A2I3TBK7_BAD-03       aaatcccagtgcagggatgcttgcgg--aagca-----------------
A0A2I3TBK7_BAD-01       gcacagcaacccaga------tgcggcaaagct-----------------

H2QLU7_BIK-01           --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SN61_BCL2L11      ---------gatccccgcttttcatctttatgagaagatcctccctgctg
A0A2I3SN61_BCL2L11      ---------gatccccgcttttcatctttatgagaagatcctccctgctg
H2Q6Y8_HRK-01           --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       ccctgccagtttcccagcagtcttgcccattggggagcagccccccgaag
A0A2I3TBK7_BAD-03       -tcagcagggatgtccgcc--ccagcc---gctgactcagaagcccaaca
A0A2I3TBK7_BAD-01       -ccagc-tggacgcgagtcttccagtcctggtgggatcggaactt-----

H2QLU7_BIK-01           --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SN61_BCL2L11      tctcga--------------------------------------------
A0A2I3SN61_BCL2L11      tctcga--------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       ggcagtggcaacatcgagcagaggtacagattgcccgaaagcttcagtgc
A0A2I3TBK7_BAD-03       cgcaga------------------------------gaatgtaaagct--
A0A2I3TBK7_BAD-01       ----gg------------------------------gcaggggaagctcc

H2QLU7_BIK-01           ---------------------------acaggtgctgctggcgctgctgc
A0A2I3SX38_PMAIP1-      ----------------------------aacttccggcagaaacttctga
A0A2I3SX38_PMAIP1-      ----------------------------aacttccggcagaaacttctga
A0A2I3SN61_BCL2L11      ----tcctccagtgggtatttctcttttgacacagacaggagcc--cagc
A0A2I3SN61_BCL2L11      ----tcctccagtgggtatttctcttttgacacagacaggagcc--cagc
H2Q6Y8_HRK-01           ------------tggccttggc------tgtgcgcggccgcgcaggtggc
A0A2I3RGH5_BBC3-03      --------cggacgacctcaacgcgcagtacgagcggcggagacaagagg
A0A2I3RIG5_BBC3-02      --------cggacgacctcaacgcgcagtacgagcggcggagacaagagg
A0A2J8QDD5_BMF-01       ----------------------------------------caccagcaga
A0A2J8QDD5_BMF-02       attgcagaccagttccaccggcttc----atgtgcagcaacaccagcaga
A0A2I3TBK7_BAD-03       ----------agaggcgctggggctgtggagatccggagtcgcca-cagc
A0A2I3TBK7_BAD-01       gccccctcccagtgaccttcgctcc----acatcccgaaactccacccgt

H2QLU7_BIK-01           tgc---------------------------------tgctggcgctgctg
A0A2I3SX38_PMAIP1-      atc---------------------------------tgatatccaaactc
A0A2I3SX38_PMAIP1-      atc---------------------------------tgatatccaaactc
A0A2I3SN61_BCL2L11      accca---------------------------tgagttgtgacaaatcaa
A0A2I3SN61_BCL2L11      accca---------------------------tgagttgtgacaaatcaa
H2Q6Y8_HRK-01           ggcgc-------------------------------tggcggcctggctg
A0A2I3RGH5_BBC3-03      agcag-------------------------------cagcggcaccgccc
A0A2I3RIG5_BBC3-02      agcag-------------------------------cagcggcaccgccc
A0A2J8QDD5_BMF-01       accaa----------------------aatcgtgtgtggtggcagatcc-
A0A2J8QDD5_BMF-02       accaa----------------------aatcgtgtgtggtggcagatcc-
A0A2I3TBK7_BAD-03       tcctaccccgcggggacggaggacgacga--agggatgggggaggagccc
A0A2I3TBK7_BAD-01       tcccactgccctggg--------cagccatcttgaatatgggcggaagt-

H2QLU7_BIK-01           ctgcc--------gctgctcagcgg-------------------------
A0A2I3SX38_PMAIP1-      t------------tctgctcag----------------------------
A0A2I3SX38_PMAIP1-      t------------tctgctcag----------------------------
A0A2I3SN61_BCL2L11      cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgca
A0A2I3SN61_BCL2L11      cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgca
H2Q6Y8_HRK-01           c------------tcggc--------------------------------
A0A2I3RGH5_BBC3-03      c------------tcgccctggagggtcctgtacaatctcatcatgggac
A0A2I3RIG5_BBC3-02      c------------tcgccctggagggtcctgtacaatctcatcatgggac
A0A2J8QDD5_BMF-01       -------------tcctctt----------------------cctgcaca
A0A2J8QDD5_BMF-02       -------------tcctctt----------------------cctgcaca
A0A2I3TBK7_BAD-03       a------------gcccctttcggggccgctcgc------gctcggcgcc
A0A2I3TBK7_BAD-01       -------------acttccctcaggcctatgcaaaaagaggatccgtgct
                                      *  *                                

H2QLU7_BIK-01           -------------------------------------gggcctgcacctg
A0A2I3SX38_PMAIP1-      -----------------gaacctga-------------------------
A0A2I3SX38_PMAIP1-      -----------------gaacctgactgcatcaaaaacttgcatgagggg
A0A2I3SN61_BCL2L11      atggct-----------------aactg----------------------
A0A2I3SN61_BCL2L11      atggcttccatgaggcaggctgaacctgcagatatgcgaccggagatatg
H2Q6Y8_HRK-01           ---------------------------------------------aggcg
A0A2I3RGH5_BBC3-03      tcctgcccttaccc---aggggccacag---------agcccccgagatg
A0A2I3RIG5_BBC3-02      tcctgcccttaccc---aggggccacag---------agcccccgagatg
A0A2J8QDD5_BMF-01       accttgctttgaatggagaagagaacag---------gaacggggc----
A0A2J8QDD5_BMF-02       accttgctttgaatggagaagagaacag---------gaacggggc----
A0A2I3TBK7_BAD-03       ccccaacctct------gggcagcacag---------cgctatggccgcg
A0A2I3TBK7_BAD-01       gtct--ccttt------ggaggg---ag---------ggc--tgaccccg

H2QLU7_BIK-01           ctgctc--------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      actccttcaaaagagttttctcaggaggtgcacgtttcatcaatttgaag
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      gatcgcccaagagttgcggcgtatcggagacgagtttaacgcttactatg
H2Q6Y8_HRK-01           gaactt--------------------------------------------
A0A2I3RGH5_BBC3-03      gagccc--------------------------------------------
A0A2I3RIG5_BBC3-02      gagccc--------------------------------------------
A0A2J8QDD5_BMF-01       aggccc--------------------------------------------
A0A2J8QDD5_BMF-02       aggccc--------------------------------------------
A0A2I3TBK7_BAD-03       agctcc------gg------------------------------------
A0A2I3TBK7_BAD-01       attcccttccggtg------------------------------------

H2QLU7_BIK-01           --------------aagtga
A0A2I3SX38_PMAIP1-      --------------------
A0A2I3SX38_PMAIP1-      aaagactgcattgtaattgg
A0A2I3SN61_BCL2L11      -------------ggactag
A0A2I3SN61_BCL2L11      caaggaggttagagaaatag
H2Q6Y8_HRK-01           --------------g--tag
A0A2I3RGH5_BBC3-03      --------------aattag
A0A2I3RIG5_BBC3-02      --------------aattag
A0A2J8QDD5_BMF-01       -------------tag----
A0A2J8QDD5_BMF-02       -------------taggtga
A0A2I3TBK7_BAD-03       -------------aggatga
A0A2I3TBK7_BAD-01       -------------cgtgtga

© 1998-2020Legal notice