Dataset for CDS classical BH3-containing proteins of organism Ornithorhynchus anatinus

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A6I8NCK5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BCL2L11 (length=552 residues).
atggccaagcaaccttccgacctaaattctgaatgtgacagcgaaggcggacgactggagcccgcagaggggccggctca
gcccccgcagctccgacccggggcacctacctctatccgaacccagtatcaagacaggagccctccgcctgtgagttgcg
ataaatcgacccagacccccagtccccactgtcaagccttcaatcattatctaagtgcaatggcttccattagacagcct
cagtctgttcctgaagatatgcggccggaaatatggattgcccaggagttacggcgaattggagatgagtttaacgcttc
ctattgtccaagaaggggtctcttggataataaatccggcaggaaacaaccaccaaatgggttttgtgcacctgttacgt
tacatcctccgccgcgttggcgaactgcagtgactgtttcttggagaagcgaagacccccgggtgttcacctcatcctca
gcggagcaaaccagagcggtggtagcttctccaatctacaactatgcaattgacactgttcctcatggataa
>gnl|bcl2dbcds|A0A6I8NCK5_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BCL2L11 (length=462 residues).
atggccaagcaaccttccgacctaaattctgaatgtgacagcgaaggcggacgactggagcccgcagaggggccggctca
gcccccgcagctccgacccggggcacctacctctatccgaacccagtatcaagcttccattagacagcctcagtctgttc
ctgaagatatgcggccggaaatatggattgcccaggagttacggcgaattggagatgagtttaacgcttcctattgtcca
agaaggggtctcttggataataaatccggcaggaaacaaccaccaaatgggttttgtgcacctgttacgttacatcctcc
gccgcgttggcgaactgcagtgactgtttcttggagaagcgaagacccccgggtgttcacctcatcctcagcggagcaaa
ccagagcggtggtagcttctccaatctacaactatgcaattgacactgttcctcatggataa
>gnl|bcl2dbcds|A0A6I8NCK5_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BCL2L11 (length=429 residues).
atggccaagcaaccttccgacctaaattctgaatgtgacagcgaaggcggacgactggagcccgcagaggggccggctca
gcccccgcagctccgacccggggcacctacctctatccgaacccagtatcaagacaggagccctccgcctgtgagttgcg
ataaatcgacccagacccccagtccccactgtcaagccttcaatcattatctaagtgcaatggcttccattagacagcct
cagtctgttcctgaagatatgcggccggaaatatggattgcccaggagttacggcgaattggagatgagtttaacgcttc
ctattgtccaagaagggaaatgcttgatgtgagaccagacctactcggcttggggataaattctaccttgccaggcgaca
cgctgccccatccggggccagatatgtag
>gnl|bcl2dbcds|A0A6I8NCK5_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BCL2L11 (length=576 residues).
atggccaagcaaccttccgacctaaattctgaatgtgacagcgaaggcggacgactggagcccgcagaggggccggctca
gcccccgcagctccgacccggggcacctacctctatccgaacccagtatcaaggtaatctctcgggcggaggggaaagct
gttcacagggcccgttcccgccgtccagtagccccaggccgtttgccaccagatccccacttttcatctttgtccgaaga
tcgtcgctgctgtctagatcctccagcgggtatttctcttttgacacagacaggagccctccgcctgtgagttgcgataa
atcgacccagacccccagtccccactgtcaagccttcaatcattatctaagtgcaatggcttccattagacagcctcagt
ctgttcctgaagatatgcggccggaaatatggattgcccaggagttacggcgaattggagatgagtttaacgcttcctat
tgtccaagaaggtttgctgtgcggccagaagtgcggagaggattaccaagtactccggagagaacagagagggagaaaaa
cttctttggaacttga
>gnl|bcl2dbcds|A0A6I8NCK5_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BCL2L11 (length=471 residues).
atggccaagcaaccttccgacctaaattctgaatgtgacagcgaaggcggacgactggagcccgcagaggggccggctca
gcccccgcagctccgacccggggcacctacctctatccgaacccagtatcaagacaggagccctccgcctgtgagttgcg
ataaatcgacccagacccccagtccccactgtcaagccttcaatcattatctaagtgcaatggcttccattagacagcct
cagtctgttcctgaagatatgcggccggaaatatggattgcccaggagttacggcgaattggagatgagtttaacgcttc
ctattgtccaagaaggacagggatgactggaggtcttgttttcatggggaggttgctgtcggatatgtttgctgtgcggc
cagaagtgcggagaggattaccaagtactccggagagaacagagagggagaaaaacttctttggaacttga
>gnl|bcl2dbcds|A0A6I8NF73_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BMF (length=651 residues).
atgaagtggccttggccaggacggagatacggatgcgcccgctctctctccgcaggcaggatggagttgtcccagtacga
ggaggagctggaggagctgacggggctggaggagctggaggatgacgtcttccaccctgagacgcctgtggcggagtccc
tggcacagcccggcggcccggcccccgctgccccactcacccccggtcagccctacagctacctggtcgggcagctgccc
ctcttccctctcgctccctgctgtgggccgggactgcggaccctgagccaagaagacaagaccactcagaccctgagccc
ggccgccccgagccaaggcgtcatgctgccctgcggagtgaccgaagagccccggcgcctcttctacggccacgccgggt
accgcctctcttccctcaccagctttcccggggaccccagtctcggcgaggagccccccgaggcgccgtgggaacggaga
cccgaaatgcaggtcgcccgcaagctgcagtgcatcgcggaccagtttcatcgtctccatacccagcggcaccaacggaa
ccggaaccacgtttggtggcgggtcctgcctctcctgcacaatctggctctgggcatggaggaaaatgggcagggagggg
gccccaggtga
>gnl|bcl2dbcds|A0A6I8NVP2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BAD (length=510 residues).
atgtttcagattccggagtttgagccgagcgagcggggggacgtctgcaccccgggaggtgaccccagccaggccccagc
gggaccggggggcctgggtcgccacacccacacctcccccgacctagcgtcgcacctccccggacggaggccgccgcccg
cggcccacctcagtgaagcccctcctttcagctggcttcccccccgcctccccccggccacaggtcccagagcaaaggag
ccgtccggacgcctgaactcggaacccccggattccgaggcggaggaacacagcccgtttaggggtcgctcgcactcggc
accccccatcctctgggtcgcccagcgttacggccgcgagctccgcaggatgagtgacgagttcgactgcactttccagg
gtctgccccggccgaagagcgcgggcaccgcggcgcagttgcagcgaccctcgggctggacccgcgtcctccgctcctgg
tggaatcgcagctccagctctgcccagtga
© 1998-2022Legal notice