Dataset for CDS classical BH3-containing proteins of organism Ornithorhynchus anatinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A6I8NCK5_BCL2L11      atg--------------------gccaagcaacc----------------
A0A6I8NCK5_BCL2L11      atg--------------------gccaagcaacc----------------
A0A6I8NCK5_BCL2L11      atg--------------------gccaagcaacc----------------
A0A6I8NCK5_BCL2L11      atg--------------------gccaagcaacc----------------
A0A6I8NCK5_BCL2L11      atg--------------------gccaagcaacc----------------
A0A6I8NF73_BMF-01       atg---------aagtggccttggcca---ggacggagatacggatgcgc
A0A6I8NVP2_BAD-01       atgtttcagattccggagtttgagccgagcgagcggggggacgtctgcac
                        ***                    ***       *                

A0A6I8NCK5_BCL2L11      -------------------------------ttccgacc----taaattc
A0A6I8NCK5_BCL2L11      -------------------------------ttccgacc----taaattc
A0A6I8NCK5_BCL2L11      -------------------------------ttccgacc----taaattc
A0A6I8NCK5_BCL2L11      -------------------------------ttccgacc----taaattc
A0A6I8NCK5_BCL2L11      -------------------------------ttccgacc----taaattc
A0A6I8NF73_BMF-01       ccgctctctctccgcaggcaggatggagttgtcccagtacgaggaggagc
A0A6I8NVP2_BAD-01       cc----------------cggga---ggtgaccccagcc-----------
                                                         **               

A0A6I8NCK5_BCL2L11      tgaatgtgacagcgaaggcggacga-ctggag------------------
A0A6I8NCK5_BCL2L11      tgaatgtgacagcgaaggcggacga-ctggag------------------
A0A6I8NCK5_BCL2L11      tgaatgtgacagcgaaggcggacga-ctggag------------------
A0A6I8NCK5_BCL2L11      tgaatgtgacagcgaaggcggacga-ctggag------------------
A0A6I8NCK5_BCL2L11      tgaatgtgacagcgaaggcggacga-ctggag------------------
A0A6I8NF73_BMF-01       tggaggagctgacggggctggaggagctggaggatgacgtcttc-caccc
A0A6I8NVP2_BAD-01       ---aggccccagcgggaccggggggcctgggtcgccacacccacacctcc
                           * *      **     **  *  ****                    

A0A6I8NCK5_BCL2L11      -------cccgcagaggggcc----------------ggctcagcccccg
A0A6I8NCK5_BCL2L11      -------cccgcagaggggcc----------------ggctcagcccccg
A0A6I8NCK5_BCL2L11      -------cccgcagaggggcc----------------ggctcagcccccg
A0A6I8NCK5_BCL2L11      -------cccgcagaggggcc----------------ggctcagcccccg
A0A6I8NCK5_BCL2L11      -------cccgcagaggggcc----------------ggctcagcccccg
A0A6I8NF73_BMF-01       tgagacgcctgtggcggagtccctggcacagcccggcggcccggcccccg
A0A6I8NVP2_BAD-01       cccgac-ctagcgtcgcacctccccggacgg------aggccgccgcccg
                               *  *    *                      *  *  * ****

A0A6I8NCK5_BCL2L11      cagctc----cgacccggggca--cctacctctatccgaacccagtatca
A0A6I8NCK5_BCL2L11      cagctc----cgacccggggca--cctacctctatccgaacccagtatca
A0A6I8NCK5_BCL2L11      cagctc----cgacccggggca--cctacctctatccgaacccagtatca
A0A6I8NCK5_BCL2L11      cagctc----cgacccggggca--cctacctctatccgaacccagtatca
A0A6I8NCK5_BCL2L11      cagctc----cgacccggggca--cctacctctatccgaacccagtatca
A0A6I8NF73_BMF-01       ctgccccactcacccccggtcagccctacagctacctggtc---------
A0A6I8NVP2_BAD-01       cggcc-----cacctcagtgaagcccctccttt-----------------
                        * **      *  * * *   *  **  *   *                 

A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      aggtaatctctcgggcggaggggaaagctgttcacagggcccgttcccgc
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NF73_BMF-01       --------------------------------------------------
A0A6I8NVP2_BAD-01       --------------------------------------------------
                                                                          

A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      cgtccagtagccccaggccgtttgccaccagatccccacttttcatcttt
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NF73_BMF-01       --------------------------------------------------
A0A6I8NVP2_BAD-01       --------------------------------------------------
                                                                          

A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      gtccgaagatcgtcgctgctgtctagatcctccagcgggtatttctcttt
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NF73_BMF-01       --------------------------------------------------
A0A6I8NVP2_BAD-01       --------------------------------------------------
                                                                          

A0A6I8NCK5_BCL2L11      ------agacaggagccct-----ccgcctgtgagttgcgataaat----
A0A6I8NCK5_BCL2L11      ------a-------------------------------------------
A0A6I8NCK5_BCL2L11      ------agacaggagccct-----ccgcctgtgagttgcgataaat----
A0A6I8NCK5_BCL2L11      tgacacagacaggagccct-----ccgcctgtgagttgcgataaat----
A0A6I8NCK5_BCL2L11      ------agacaggagccct-----ccgcctgtgagttgcgataaat----
A0A6I8NF73_BMF-01       ------gggcagctgcccctcttccctctcgctccctgctgtgggccggg
A0A6I8NVP2_BAD-01       ---------cagctggcttcccccccgcctccccccggccacaggt----
                                                                          

A0A6I8NCK5_BCL2L11      -----------------------------cgacccagacccc--------
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      -----------------------------cgacccagacccc--------
A0A6I8NCK5_BCL2L11      -----------------------------cgacccagacccc--------
A0A6I8NCK5_BCL2L11      -----------------------------cgacccagacccc--------
A0A6I8NF73_BMF-01       actgcggaccctgagccaagaagacaagaccactcagac-cctgagcccg
A0A6I8NVP2_BAD-01       --------cccagagcaaaggag------ccgtccggacgcctgaactcg
                                                                          

A0A6I8NCK5_BCL2L11      -cagtccccactgtcaagccttcaatc-----------attatctaagtg
A0A6I8NCK5_BCL2L11      --------------------------------------------------
A0A6I8NCK5_BCL2L11      -cagtccccactgtcaagccttcaatc-----------attatctaagtg
A0A6I8NCK5_BCL2L11      -cagtccccactgtcaagccttcaatc-----------attatctaagtg
A0A6I8NCK5_BCL2L11      -cagtccccactgtcaagccttcaatc-----------attatctaagtg
A0A6I8NF73_BMF-01       gccgccccgag--ccaaggcgtcatgctgccctgcggagtgaccgaagag
A0A6I8NVP2_BAD-01       gaacccccggattccgaggcg-----------------------gaggaa
                                                                          

A0A6I8NCK5_BCL2L11      caatg------------------gcttccattagacagcctcagtct---
A0A6I8NCK5_BCL2L11      -----------------------gcttccattagacagcctcagtct---
A0A6I8NCK5_BCL2L11      caatg------------------gcttccattagacagcctcagtct---
A0A6I8NCK5_BCL2L11      caatg------------------gcttccattagacagcctcagtct---
A0A6I8NCK5_BCL2L11      caatg------------------gcttccattagacagcctcagtct---
A0A6I8NF73_BMF-01       ccccggcgcctcttcta-----cggccacgccgggtaccgcctctcttcc
A0A6I8NVP2_BAD-01       cacag----cccgtttaggggtcgctcgcactcggcaccccccatcct--
                                               *    *    *  * *  *  **    

A0A6I8NCK5_BCL2L11      ----------------------------------------gttcctgaag
A0A6I8NCK5_BCL2L11      ----------------------------------------gttcctgaag
A0A6I8NCK5_BCL2L11      ----------------------------------------gttcctgaag
A0A6I8NCK5_BCL2L11      ----------------------------------------gttcctgaag
A0A6I8NCK5_BCL2L11      ----------------------------------------gttcctgaag
A0A6I8NF73_BMF-01       ctcaccagctttcccggggacccca--gtctcggcgaggagccccccgag
A0A6I8NVP2_BAD-01       -------------ctgggtcgcccagcgttacggccgcgagctccgcagg
                                                                *  **    *

A0A6I8NCK5_BCL2L11      at---atgcggccggaaatatggattgc---------------------c
A0A6I8NCK5_BCL2L11      at---atgcggccggaaatatggattgc---------------------c
A0A6I8NCK5_BCL2L11      at---atgcggccggaaatatggattgc---------------------c
A0A6I8NCK5_BCL2L11      at---atgcggccggaaatatggattgc---------------------c
A0A6I8NCK5_BCL2L11      at---atgcggccggaaatatggattgc---------------------c
A0A6I8NF73_BMF-01       gcgccgtgggaacggagacccgaaatgca--------ggt------cgcc
A0A6I8NVP2_BAD-01       at-------gagtgacgagttcgactgcactttccagggtctgccccggc
                                 *   *   *     * ***                     *

A0A6I8NCK5_BCL2L11      caggagttacggcgaattggagatgagtttaacgcttcctattgtccaag
A0A6I8NCK5_BCL2L11      caggagttacggcgaattggagatgagtttaacgcttcctattgtccaag
A0A6I8NCK5_BCL2L11      caggagttacggcgaattggagatgagtttaacgcttcctattgtccaag
A0A6I8NCK5_BCL2L11      caggagttacggcgaattggagatgagtttaacgcttcctattgtccaag
A0A6I8NCK5_BCL2L11      caggagttacggcgaattggagatgagtttaacgcttcctattgtccaag
A0A6I8NF73_BMF-01       cgcaagctgcagtgcatcgcggaccagtttcatcgtctccatacccagcg
A0A6I8NVP2_BAD-01       cgaagagcgcgg-gcaccgcggcgcagttgcagcgaccctc---------
                        *        * * * *  *  *   ****  *      *           

A0A6I8NCK5_BCL2L11      aag------gggtctcttggataataaatccggcaggaaacaaccaccaa
A0A6I8NCK5_BCL2L11      aag------gggtctcttggataataaatccggcaggaaacaaccaccaa
A0A6I8NCK5_BCL2L11      aag---------------------------------------------gg
A0A6I8NCK5_BCL2L11      aag-----------------------------------------------
A0A6I8NCK5_BCL2L11      aaggacagggatgactggaggtcttgttttcatggggaggttgctgtcgg
A0A6I8NF73_BMF-01       gca-----------------------------------------------
A0A6I8NVP2_BAD-01       --------------------------------------------------
                                                                          

A0A6I8NCK5_BCL2L11      atgggttttgtgcacctgttacgttacatcctccgccgcgttggcgaact
A0A6I8NCK5_BCL2L11      atgggttttgtgcacctgttacgttacatcctccgccgcgttggcgaact
A0A6I8NCK5_BCL2L11      aaatgcttgatgt------------------------------gagacca
A0A6I8NCK5_BCL2L11      ----gtttgctgt------------------------------gcggcca
A0A6I8NCK5_BCL2L11      atatgtttgctgt------------------------------gcggcca
A0A6I8NF73_BMF-01       --------------------------------------ccaacggaaccg
A0A6I8NVP2_BAD-01       --------------------------------------------gggctg
                                                                          

A0A6I8NCK5_BCL2L11      gcagtgactgtttcttggagaagcgaaga--------cccccgggtgttc
A0A6I8NCK5_BCL2L11      gcagtgactgtttcttggagaagcgaaga--------cccccgggtgttc
A0A6I8NCK5_BCL2L11      gaccta-------ctcggcttggggataaattctaccttgccaggcgaca
A0A6I8NCK5_BCL2L11      gaagtg-------c-------ggagagga--------ttaccaag-----
A0A6I8NCK5_BCL2L11      gaagtg-------c-------ggagagga--------ttaccaag-----
A0A6I8NF73_BMF-01       gaacca-------cgtttggtggcgggtc--------ctgcct-------
A0A6I8NVP2_BAD-01       gacccg-------cgt---------------------cctccg-------
                        *            *                          **        

A0A6I8NCK5_BCL2L11      acctcatcctcagcggagcaaaccagagcggtggtagcttctccaatcta
A0A6I8NCK5_BCL2L11      acctcatcctcagcggagcaaaccagagcggtggtagcttctccaatcta
A0A6I8NCK5_BCL2L11      cgctg--ccccatccggg---gccagatatgtag----------------
A0A6I8NCK5_BCL2L11      ---ta--ctccgg-agag---aacagagagggagaaaaacttct------
A0A6I8NCK5_BCL2L11      ---ta--ctccgg-agag---aacagagagggagaaaaacttct------
A0A6I8NF73_BMF-01       -------ctcctg----------cacaa-tctgg------ctctgggcat
A0A6I8NVP2_BAD-01       -------ctcctggtgga---atcgcagctccag------ctctg-----
                               *  *            *  *      *                

A0A6I8NCK5_BCL2L11      caactatgcaattgacactgttcctcatggataa
A0A6I8NCK5_BCL2L11      caactatgcaattgacactgttcctcatggataa
A0A6I8NCK5_BCL2L11      ----------------------------------
A0A6I8NCK5_BCL2L11      -----------ttggaact------------tga
A0A6I8NCK5_BCL2L11      -----------ttggaact------------tga
A0A6I8NF73_BMF-01       ggaggaaaatgggcagggagggggccccaggtga
A0A6I8NVP2_BAD-01       --------------------------cccagtga
                                                          

© 1998-2020Legal notice