Dataset for CDS classical BH3-containing proteins of organism Oreochromis aureus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A668TQU8_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Oreochromis aureus GN=BMF (length=372 residues).
atggacgatgaggaggacgatgtgtttgagccaaaagccaactgttggcgcaccacattcagggagataaagtgtgaaca
tcgaggcacacagacacccggtcctgccctggtaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtgagtgttactgcactgatctcacccctgcgaggcgacaagaaatcgcggagcagcaaaacagcatg
gagcgcctgccccggcagcaacctgcggctcgcagcgtggaggcctgcatcggacagaaactccagctcataggagacca
gtttcactgggaacgcctgcaactggtgaggaggatggatgcgttcggctga
>gnl|bcl2dbcds|A0A668V3Q4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oreochromis aureus GN=BAD (length=477 residues).
atggctgcaaacttcacaatttcagacagtgaatcggagacatcagaggaggtaggggaagaagaaaaccaacagccagc
aggacaagatcaagaaagcaagccccagacacttgcccttcctgtaatcaaaacgacaggtgctggaaggctcaggctaa
actcagagtcccacacttcctcagttgccagggatgaggacctcatggctagaggggaggatgaggtctgtactcccaca
gagggagacccattcaggcgaaggtcaaagtcagctccccctgctctgtgggctgccaagaagtacggccagaagcttcg
acggatgagtgacgagtttgacagcctactagataaaggggagatgaagctcaagaagctgcaccactctaaaacctggt
ggagctacctctttagtcaccaagagactgaaggagagaacaaccatcttgaaaaccacaaccaacgcactgagtaa
© 1998-2020Legal notice