Dataset for CDS classical BH3-containing proteins of organism Oreochromis aureus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A668TQU8_BMF-01      atg---------------------gacgatgaggagga------cgatgt
A0A668V3Q4_BAD-01      atggctgcaaacttcacaatttcagacagtgaatcggagacatcagagga
                       ***                     ***  ***   ***       ** * 

A0A668TQU8_BMF-01      gtttgagccaaaagccaactgttggcgcaccacattcagggagataaagt
A0A668V3Q4_BAD-01      ggtaggggaagaagaaaac----------caacagccagcaggacaagat
                       * * * *  * ***  ***          * ***  ***   ** **  *

A0A668TQU8_BMF-01      gtgaacatcgaggcacacagacacccggtcctgccctggtaccaaacaac
A0A668V3Q4_BAD-01      caagaaagcaag--ccccagacacttg--cccttcctgtaatcaa--aac
                           * * * **   * *******  *  **   ****  * ***  ***

A0A668TQU8_BMF-01      ggca--tgctgccctgtggagtcgcaga-ggagcccaga---ccactctt
A0A668V3Q4_BAD-01      gacaggtgctg------gaaggctcaggctaaactcagagtcccacactt
                       * **  *****      * ** * ***    * * ****   **** ***

A0A668TQU8_BMF-01      ctacggtgagtgttactgcactgatctcacccctgcgaggcgacaagaaa
A0A668V3Q4_BAD-01      cctcagttgccagggatgag--gacctcatggctagaggggaggatgagg
                       *  * **         **    ** ****   **    **    * **  

A0A668TQU8_BMF-01      t---------cgcggag-----------cagcaaaacagcatggagcgcc
A0A668V3Q4_BAD-01      tctgtactcccacagagggagacccattcaggcgaaggtcaaag-tcagc
                       *         * * ***           ***   **   **  *  *  *

A0A668TQU8_BMF-01      tgccccggcagcaacctgcggctcgcagcgtggaggcctgcatcggacag
A0A668V3Q4_BAD-01      tccccctgc-----tctgtgg---gctgccaagaagta-----cggccag
                       * **** **      *** **   ** **   ** *       *** ***

A0A668TQU8_BMF-01      aaactccagctcataggagaccagtttcac--------------------
A0A668V3Q4_BAD-01      aagcttcgacggatgagtgacgagtttgacagcctactagataaagggga
                       ** ** *  *  **  * *** ***** **                    

A0A668TQU8_BMF-01      -------------------------------------tgggaacgcct--
A0A668V3Q4_BAD-01      gatgaagctcaagaagctgcaccactctaaaacctggtggagctacctct
                                                            ***     ***  

A0A668TQU8_BMF-01      -----------gcaactggtgaggaggatg--------------------
A0A668V3Q4_BAD-01      ttagtcaccaagagactgaaggagagaacaaccatcttgaaaaccacaac
                                  *  ****  *  *** *                      

A0A668TQU8_BMF-01      -gatgcgttcggctga
A0A668V3Q4_BAD-01      caacgcact-gagtaa
                         * **  * *  * *

© 1998-2021Legal notice