Dataset for CDS classical BH3-containing proteins of organism Oncorhynchus kisutch

[Download (right click)] [Alignment] [Repertoires]

13 sequence(s)

>gnl|bcl2dbcds|A0A8C7DT45_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oncorhynchus kisutch GN=BAD (length=453 residues).
atggctcagatgtttactatatcagacagcgagtcagagccctcagaggaggtaggagaaaccgaaaaggaccaatcgtc
tgccggaaaggggatgactggcggtccaataggccacgccctcactgtgcctgagatgagactggcaggagagggtcggt
tgaggatgaactcagagtcccaggcccaggagctccagggtagggggccaggggtggaaggcatgcccacagacggagca
tctttccggggtcgctcccagtcggccccccctgccctctgggcggccaagagatacgggcggcagctccgacgcatgag
tgacgagttcgatacgtggctggataaagggaggtgctactgcaaggtcttccgttgcagcccaaatcaaccccctacac
ttccaggcggtcccaattcattccctatcccctcgatgttaggggctggatag
>gnl|bcl2dbcds|A0A8C7DT45_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oncorhynchus kisutch GN=BAD (length=594 residues).
atggctcagatgtttactatatcagacagcgagtcagagccctcagaggaggtaggagaaaccgaaaaggaccaatcgtc
tgccggaaaggggatgactggcggtccaataggccacgccctcactgtgcctgagatgagactggcaggagagggtcggt
tgaggatgaactcagagtcccaggcccaggagctccagggtagggggccaggggtggaaggcatgcccacagacggagca
tctttccggggtcgctcccagtcggccccccctgccctctgggcggccaagagatacgggcggcagctccgacgcatgag
tgacgagttcgatacgtggctggataaaggggagatgaggcgggtgaagagtgcgggagcagccaaacagatgaccaagt
cccccagctggtgggcctacctgttcagtcataaggagacagagagatggagaagggagaggattggaaggcggggggga
tgggcctacctgttctctcaccaagagacaacccaccgtaatcgtaccactattgaaccacggtcatcagagtacagaga
aggggatgtttcccatgccaataaagccccttga
>gnl|bcl2dbcds|A0A8C7DT45_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oncorhynchus kisutch GN=BAD (length=1074 residues).
atgccaagactgagttggcctcctgagctaaagcttggtacaaagattcagggtctattcagggtcaagcacatgtgtaa
taatgttgtcttcctctcctctctgcctcttttctctttctcccccctttctgccctctctccatccctcttcctctctc
tctgccctctctcgctcccctctctctctgccctctctcgctcccctctctctctctccatccctcttcctctctctctg
ccctctctctctccatccctcttcctctctctctgccctctctctctctctccatccctcttcctctctctctgccctct
ctctctctctccatccctcttcctctctctctgccctctctctctctctccatccctcttcccctctctctctgccctct
ctctctctctccatccctcttcccctctctctctccatccctcttcccctctctctctgccctctctcctctctctctgc
cctctctcctctctctctgccctctctccatctctctccatccctcttcccctctctctctccatccctcttcccctcct
cactcactcttcctccatagatgtcagcatggctcagatgtttactatatcagacagcgagtcagagccctcagaggagg
taggagaaaccgaaaaggaccaatcgtctgccggaaaggggatgactggcggtccaataggccacgccctcactgtgcct
gagatgagactggcaggagagggtcggttgaggatgaactcagagtcccaggcccaggagctccagggtagggggccagg
ggtggaaggcatgcccacagacggagcatctttccggggtcgctcccagtcggccccccctgccctctgggcggccaaga
gatacgggcggcagctccgacgcatgagtgacgagttcgatacgtggctggataaaggggagatgaggcgggtgaagagt
gcgggagcagccaaacagatgaccaagtcccccagctggtgggcctacctgttcagtcataaggagacagagacagaaca
tacccctatcatcccaccacgatcatctgagtag
>gnl|bcl2dbcds|A0A8C7FH91_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Oncorhynchus kisutch GN=BMF (length=495 residues).
atggatgatgaggaggatgatgtgtttgtgccagactcctcccactgctggcgcacagccttcagggaaataaagtacga
ggacagaggcacccagacacccagccctgccctggcactgcccaacgacatgctgccctgtggggtggcccaggagccca
gaccactcttctacggcaacgcaggctttcgattgcactttccagcgcggtttgagcaggttggagaccaggggcctcag
gagcagcatcaggtggagagagggaggatggaacggcttcaacagcagcctcagcagccagcacaaagcatggaggtctg
cattggacagaaactccaactcatcggagaccagttctaccaagaacaccttcaactgtatcaccgaaaccaaaggaaca
tgaggcccttgtggtggcgcctggcctcagctctactcaccctgctgtttgagcaggaggccatcgctggaagggggaga
gcagggtggaggtga
>gnl|bcl2dbcds|A0A8C7G467_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Oncorhynchus kisutch GN=BMF (length=480 residues).
atggacgatgaggaggatgatgtgtttgagccagactcccgctgctggcgcacagccttcagggagataaagtacgagga
caggggaacccagacacccagccctgtcctgccactgcccaataatatgctgccctgcggggtggcccaggagcccagac
cactcttctacggcaacgcaggctttcgattgcactttccagcacagtttgagcgtgttggagaccaggggcctctggga
gagcgaggggggatggagcggctcaatcggcagccccagctgccagcacgcagcatagaggtctgcattggacagaaact
ccaactcatcggagaccagttccaccaagaacaccttcaagtgtatcaccgaaaccaaaggaacatgaggcccttgtggt
ggcgcctggcctcggctctgctcaccctgctgtttgagcaggaggccatcgctggaggggggagagcagggtggaggtga
>gnl|bcl2dbcds|A0A8C7G467_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Oncorhynchus kisutch GN=BMF (length=585 residues).
atggacgatgaggaggatgatgtgtttgagccagactcccgctgctggcgcacagccttcagggagataaagtacgagga
caggggaacccagacacccagccctgtcctgccactgcccaataatatgctgccctgcggggtggcccaggagcccagac
cactcttctacggcaacgcaggctttcgattgcactttccagcacagtttgagcgtgttggagaccaggggcctctggga
gagcgaggggggatggagcggctcaatcggcagccccagctgccagcacgcagcatagaggtctgcattggacagaaact
ccaactcatcggagaccagttccaccaagaacaccttcaagtggtgagaataccaaccgtgactgactgcacagcacagc
taaagtccactgagcaggcctactgtactcagaggtctgctgagagagagactgagcagcagaagtggcttctttacggg
catccattgtggtcatgtctcagtgtcccgtgtttgttttggctagtcagtgagcatgcattagcccagtgttctgacct
ctcattctacccccccaagacgtag
>gnl|bcl2dbcds|A0A8C7HIL6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL2L11 (length=645 residues).
atgtccgattcgtccagacgacaaaatcagtccaatggctcgaccatcctaattgagagagggaaatacggagaattgaa
tcccggtggcggagcagcctccggtgccgaaccgactgacaacccccagttcagcgaaggggagcagcagtcacggggag
gaataatgatgccgaatagtctgcttggtttccagtcgaggtcgccgttgttcagaacactttccaggtcatccagtgga
tatttttcgttcgacagcgattctattccaagctccccgctattgaaagataagtcgacacagactccgagcccatctag
ccaagtcatgactcacgcactgcagcgcatgtctcaagcacaggagaccaatcgagattatgacgcgtggcccaaccccc
tccacccctatagaccacggccaccgtcaactgcaggggacatgtggccagagacactgattggccaggagcttcagcgc
attggagatgagtttaacgatctcttcatacatgggcgccttgctggcagaaacggtcatgttgcccaggcaaacctgca
ggagatgcaccaagagcccgccttcctactgtggatggggctcctgattggacgactattacagatcatcctgcagagaa
gatga
>gnl|bcl2dbcds|A0A8C7HIL6_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL2L11 (length=690 residues).
atgacattgcaccgacaaaataataaaaacagcctaactctgatacttgatctatcctacagacgacaaaatcagtccaa
tggctcgaccatcctaattgagagagggaaatacggagaattgaatcccggtggcggagcagcctccggtgccgaaccga
ctgacaacccccagttcagcgaaggggagcagcagtcacggggaggaataatgatgccgaatagtctgcttggtttccag
tcgaggtcgccgttgttcagaacactttccaggtcatccagtggatatttttcgttcgacagcgattctattccaagctc
cccgctattgaaagataagtcgacacagactccgagcccatctagccaagtcatgactcacgcactgcagcgcatgtctc
aagcacaggagaccaatcgagattatgacgcgtggcccaaccccctccacccctatagaccacggccaccgtcaactgca
ggggacatgtggccagagacactgattggccaggagcttcagcgcattggagatgagtttaacgatctcttcatacatgg
gcgccttgctggcagaaacggtcatgttgcccaggcaaacctgcaggagatgcaccaagagcccgccttcctactgtgga
tggggctcctgattggacgactattacagatcatcctgcagagaagatga
>gnl|bcl2dbcds|A0A8C7JEQ7_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Oncorhynchus kisutch GN=BMF (length=588 residues).
atggatgatgaagaggaggacatgtctcttcagcgtcctgtctcccagtgctggggcacccccttcagggaaatcaagtt
tcatgacagggagagcagggacagagaagacacccaggacaggtctacacagacgtcgactggacccaacgccattgtcc
cacggtcagagggacacggcatcatggtaccacaaggacacaacaacaacaacaactttccctgtggggtgcaggacaat
caccagggaagaatactgttccatggcaacgctggattccgcttgcacttcccagctcggttcgagcccatggacgatcg
gggagagaggcggaacgaggaggaggaggagaggaggagaatggaggagagaccagaggaagagcgggtggaggatagcg
cggaggcgaggatcggacgtaagctccgggagatcggagaccagttccaccaggaacatgttcaactgttcctgcggcat
cagagggatgtcctaccagtctggattcgtctgaccatggccctctacggcttcctgtttaacagagaggcccctgctgt
accccgcctgagaggacaggaaagatga
>gnl|bcl2dbcds|A0A8C7JEQ7_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Oncorhynchus kisutch GN=BMF (length=699 residues).
atgagggggacatgtctctctgtctctctctcaaacagactcacacacacttctgtctcacaccatttctcctgtctctc
tcctgtagggagactacctctgagactcccaatggatgatgaagaggaggacatgtctcttcagcgtcctgtctcccagt
gctggggcacccccttcagggaaatcaagtttcatgacagggagagcagggacagagaagacacccaggacaggtctaca
cagacgtcgactggacccaacgccattgtcccacggtcagagggacacggcatcatggtaccacaaggacacaacaacaa
caacaactttccctgtggggtgcaggacaatcaccagggaagaatactgttccatggcaacgctggattccgcttgcact
tcccagctcggttcgagcccatggacgatcggggagagaggcggaacgaggaggaggaggagaggaggagaatggaggag
agaccagaggaagagcgggtggaggatagcgcggaggcgaggatcggacgtaagctccgggagatcggagaccagttcca
ccaggaacatgttcaactgttcctgcggcatcagagggatgtcctaccagtctggattcgtctgaccatggccctctacg
gcttcctgtttaacagagaggcccctgctgtaccccgcctgagaggacaggaaagatga
>gnl|bcl2dbcds|A0A8C7KHU4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oncorhynchus kisutch GN=BAD (length=444 residues).
atggaccacatacatgattgtgtggatgaatgtgagtctgaccactcaggaaccacacacaactcagaatttcagctcca
tgtctcaactacaatgagcaacagaccaagaccaggtgagcgagtccggctctactcagagtcccaggtgtgctcccagg
ttggaaaaagggaagacacagagtttctggatgtgatgactcctactgaggatggcgggggtgacggggcttcattccga
ggccgatcacagtctgctcctcctgcactgtgggctgcaaagaaatatggctgccagctgaggaggatgagtgatgaatt
tgacacctggctcgacaaaggggagcccaagagagggattagcccaggaggaggcaagcagaaagtctcccgaggatggt
tctctttcctctggagtccaaaggaggcggaaggcagggagtga
>gnl|bcl2dbcds|A0A8C7KKS5_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oncorhynchus kisutch GN=BAD (length=429 residues).
atgaatgaacaagacgagtctgaccactcaggaaccacacactacccagaatttcagctccataatgtctccgctacgac
gagcatcagaccacgaccaggtgggcgagctcggctctactccgagtcccaggtgtgctcccaggttggcagaagggatg
acacagagtttcaggatgcaataactcctactgaggagggcgggggcgatggggctcctttccgaagccgatcacagtct
gctcctcctacactgtgggctgcaaagaaatatggccgccagctgaggaggatgagtgatgaatttgacacctggctcga
caaaggggagcccaagagagggattagcccaggaggggtcaagcaggaggtctcccggggatggttctctttcctctgga
gtccaaacgaggccgaaggcagggagtga
>gnl|bcl2dbcds|A0A8C7L4D1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL2L11 (length=588 residues).
ttttattacggagagtcgcatcccggtggcggagcagcctcccgtgccgaaccgtctgacaacccccagtcctgcgaagg
ggaccagcagtcacggggaggaataatgattccgaatagtctgcttggtttccagtcgaggtcgccggtgttcagaacac
tgtccaggtcctccagtggatatttttcgttcgacagcgattctattccaagctccccgctattgaaagataacaagtcg
acacagactccgagcccatctagccaagtcattacccacgcactgcagcgcatgtctcgagcactggagacccggcgaga
ttatgacgtgtggcccaaccccctccggccctatagagcaagcccgccaccgactgcggcggacatgcggccagagatac
tcatcggtcaggagcttcagcgcattggagatgagtttaacaacctcttcatacatgggcgccttgcaggcagaaacggt
caggttgcccagggaaacctgcagcagatgcaccaagagcccgccttcctactgtggatgggtcttctgattggacgact
attacagataatcctgcggagaagatga
© 1998-2022Legal notice