Dataset for CDS classical BH3-containing proteins of organism Oncorhynchus kisutch

[Download (right click)] [Edit] [Sequences] [Repertoires]

13 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C7L4D1_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      --------------------------------------------------
A0A8C7JEQ7_BMF-01       --------------------------------------------------
A0A8C7JEQ7_BMF-02       --------------------------------------------------
A0A8C7FH91_BMF-01       --------------------------------------------------
A0A8C7G467_BMF-01       --------------------------------------------------
A0A8C7G467_BMF-02       --------------------------------------------------
A0A8C7DT45_BAD-02       --------------------------------------------------
A0A8C7DT45_BAD-01       --------------------------------------------------
A0A8C7DT45_BAD-03       atgccaagactgagttggcctcctgagctaaagcttggtacaaagattca
A0A8C7KHU4_BAD-01       --------------------------------------------------
A0A8C7KKS5_BAD-01       --------------------------------------------------
                                                                          

A0A8C7L4D1_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      --------------------------------------------------
A0A8C7JEQ7_BMF-01       --------------------------------------------------
A0A8C7JEQ7_BMF-02       --------------------------------------------------
A0A8C7FH91_BMF-01       --------------------------------------------------
A0A8C7G467_BMF-01       --------------------------------------------------
A0A8C7G467_BMF-02       --------------------------------------------------
A0A8C7DT45_BAD-02       --------------------------------------------------
A0A8C7DT45_BAD-01       --------------------------------------------------
A0A8C7DT45_BAD-03       gggtctattcagggtcaagcacatgtgtaataatgttgtcttcctctcct
A0A8C7KHU4_BAD-01       --------------------------------------------------
A0A8C7KKS5_BAD-01       --------------------------------------------------
                                                                          

A0A8C7L4D1_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      --------------------------------------------------
A0A8C7JEQ7_BMF-01       --------------------------------------------------
A0A8C7JEQ7_BMF-02       --------------------------------------------------
A0A8C7FH91_BMF-01       --------------------------------------------------
A0A8C7G467_BMF-01       --------------------------------------------------
A0A8C7G467_BMF-02       --------------------------------------------------
A0A8C7DT45_BAD-02       --------------------------------------------------
A0A8C7DT45_BAD-01       --------------------------------------------------
A0A8C7DT45_BAD-03       ctctgcctcttttctctttctcccccctttctgccctctctccatccctc
A0A8C7KHU4_BAD-01       --------------------------------------------------
A0A8C7KKS5_BAD-01       --------------------------------------------------
                                                                          

A0A8C7L4D1_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      --------------------------------------------------
A0A8C7JEQ7_BMF-01       --------------------------------------------------
A0A8C7JEQ7_BMF-02       --------------------------------------------------
A0A8C7FH91_BMF-01       --------------------------------------------------
A0A8C7G467_BMF-01       --------------------------------------------------
A0A8C7G467_BMF-02       --------------------------------------------------
A0A8C7DT45_BAD-02       --------------------------------------------------
A0A8C7DT45_BAD-01       --------------------------------------------------
A0A8C7DT45_BAD-03       ttcctctctctctgccctctctcgctcccctctctctctgccctctctcg
A0A8C7KHU4_BAD-01       --------------------------------------------------
A0A8C7KKS5_BAD-01       --------------------------------------------------
                                                                          

A0A8C7L4D1_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      --------------------------------------------------
A0A8C7JEQ7_BMF-01       --------------------------------------------------
A0A8C7JEQ7_BMF-02       --------------------------------------------------
A0A8C7FH91_BMF-01       --------------------------------------------------
A0A8C7G467_BMF-01       --------------------------------------------------
A0A8C7G467_BMF-02       --------------------------------------------------
A0A8C7DT45_BAD-02       --------------------------------------------------
A0A8C7DT45_BAD-01       --------------------------------------------------
A0A8C7DT45_BAD-03       ctcccctctctctctctccatccctcttcctctctctctgccctctctct
A0A8C7KHU4_BAD-01       --------------------------------------------------
A0A8C7KKS5_BAD-01       --------------------------------------------------
                                                                          

A0A8C7L4D1_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      --------------------------------------------------
A0A8C7JEQ7_BMF-01       --------------------------------------------------
A0A8C7JEQ7_BMF-02       --------------------------------------------------
A0A8C7FH91_BMF-01       --------------------------------------------------
A0A8C7G467_BMF-01       --------------------------------------------------
A0A8C7G467_BMF-02       --------------------------------------------------
A0A8C7DT45_BAD-02       --------------------------------------------------
A0A8C7DT45_BAD-01       --------------------------------------------------
A0A8C7DT45_BAD-03       ctccatccctcttcctctctctctgccctctctctctctctccatccctc
A0A8C7KHU4_BAD-01       --------------------------------------------------
A0A8C7KKS5_BAD-01       --------------------------------------------------
                                                                          

A0A8C7L4D1_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      --------------------------------------------------
A0A8C7JEQ7_BMF-01       --------------------------------------------------
A0A8C7JEQ7_BMF-02       --------------------------------------------------
A0A8C7FH91_BMF-01       --------------------------------------------------
A0A8C7G467_BMF-01       --------------------------------------------------
A0A8C7G467_BMF-02       --------------------------------------------------
A0A8C7DT45_BAD-02       --------------------------------------------------
A0A8C7DT45_BAD-01       --------------------------------------------------
A0A8C7DT45_BAD-03       ttcctctctctctgccctctctctctctctccatccctcttcctctctct
A0A8C7KHU4_BAD-01       --------------------------------------------------
A0A8C7KKS5_BAD-01       --------------------------------------------------
                                                                          

A0A8C7L4D1_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      --------------------------------------------------
A0A8C7JEQ7_BMF-01       --------------------------------------------------
A0A8C7JEQ7_BMF-02       --------------------------------------------------
A0A8C7FH91_BMF-01       --------------------------------------------------
A0A8C7G467_BMF-01       --------------------------------------------------
A0A8C7G467_BMF-02       --------------------------------------------------
A0A8C7DT45_BAD-02       --------------------------------------------------
A0A8C7DT45_BAD-01       --------------------------------------------------
A0A8C7DT45_BAD-03       ctgccctctctctctctctccatccctcttcccctctctctctgccctct
A0A8C7KHU4_BAD-01       --------------------------------------------------
A0A8C7KKS5_BAD-01       --------------------------------------------------
                                                                          

A0A8C7L4D1_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      --------------------------------------------------
A0A8C7JEQ7_BMF-01       --------------------------------------------------
A0A8C7JEQ7_BMF-02       --------------------------------------------------
A0A8C7FH91_BMF-01       --------------------------------------------------
A0A8C7G467_BMF-01       --------------------------------------------------
A0A8C7G467_BMF-02       --------------------------------------------------
A0A8C7DT45_BAD-02       --------------------------------------------------
A0A8C7DT45_BAD-01       --------------------------------------------------
A0A8C7DT45_BAD-03       ctctctctctccatccctcttcccctctctctctccatccctcttcccct
A0A8C7KHU4_BAD-01       --------------------------------------------------
A0A8C7KKS5_BAD-01       --------------------------------------------------
                                                                          

A0A8C7L4D1_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      -----------------------atg------------------------
A0A8C7HIL6_BCL2L11      -----------------------atgacattgcaccgacaaaataataaa
A0A8C7JEQ7_BMF-01       --------------------------------------------------
A0A8C7JEQ7_BMF-02       ---------------atgagggggacatgtctctctgtctctctctcaaa
A0A8C7FH91_BMF-01       --------------------------------------------------
A0A8C7G467_BMF-01       --------------------------------------------------
A0A8C7G467_BMF-02       --------------------------------------------------
A0A8C7DT45_BAD-02       --------------------------------------------------
A0A8C7DT45_BAD-01       --------------------------------------------------
A0A8C7DT45_BAD-03       ctctctctgccctctctcctctctctctgccctctctcctctctctctgc
A0A8C7KHU4_BAD-01       --------------------------------------------------
A0A8C7KKS5_BAD-01       --------------------------------------------------
                                                                          

A0A8C7L4D1_BCL2L11      -----------ttttat---------------------------------
A0A8C7HIL6_BCL2L11      -----------tccgat----------tcgtccagacgacaaaatcagtc
A0A8C7HIL6_BCL2L11      aacagcctaactctgatacttgatctatcctacagacgacaaaatcagtc
A0A8C7JEQ7_BMF-01       --------------------------------------------------
A0A8C7JEQ7_BMF-02       cagactcacacacacttctgtctcacaccatttctcctgtctctctcctg
A0A8C7FH91_BMF-01       --------------------------------------------------
A0A8C7G467_BMF-01       --------------------------------------------------
A0A8C7G467_BMF-02       --------------------------------------------------
A0A8C7DT45_BAD-02       --------------------------------------------------
A0A8C7DT45_BAD-01       --------------------------------------------------
A0A8C7DT45_BAD-03       cctctctccatctctctccatccctcttcccctctctctctccatccctc
A0A8C7KHU4_BAD-01       --------------------------------------------------
A0A8C7KKS5_BAD-01       --------------------------------------------------
                                                                          

A0A8C7L4D1_BCL2L11      ----------------------------------tacggagagtcgcatc
A0A8C7HIL6_BCL2L11      caatggctcgaccatcctaattgagagagggaaatacggagaattgaatc
A0A8C7HIL6_BCL2L11      caatggctcgaccatcctaattgagagagggaaatacggagaattgaatc
A0A8C7JEQ7_BMF-01       --------------------------atggatgatgaagaggaggacatg
A0A8C7JEQ7_BMF-02       tagggagactacctctgagactcccaatggatgatgaagaggaggacatg
A0A8C7FH91_BMF-01       --------------------------atggatgatgaggaggatgatgtg
A0A8C7G467_BMF-01       --------------------------atggacgatgaggaggatgatgtg
A0A8C7G467_BMF-02       --------------------------atggacgatgaggaggatgatgtg
A0A8C7DT45_BAD-02       --------------------------------------atggctcagatg
A0A8C7DT45_BAD-01       --------------------------------------atggctcagatg
A0A8C7DT45_BAD-03       ttcccctcctcactcactcttcctccatagatgtcagcatggctcagatg
A0A8C7KHU4_BAD-01       --------------------------------------atggaccacata
A0A8C7KKS5_BAD-01       --------------------------------------atgaat------
                                                                *         

A0A8C7L4D1_BCL2L11      ccggtggcggagca--gcctcccgtgccgaaccgtctgacaacccccag-
A0A8C7HIL6_BCL2L11      ccggtggcggagca--gcctccggtgccgaaccgactgacaacccccag-
A0A8C7HIL6_BCL2L11      ccggtggcggagca--gcctccggtgccgaaccgactgacaacccccag-
A0A8C7JEQ7_BMF-01       tctcttcagcgtcctgtctcccagtgctggggc-----acccccttcagg
A0A8C7JEQ7_BMF-02       tctcttcagcgtcctgtctcccagtgctggggc-----acccccttcagg
A0A8C7FH91_BMF-01       t---ttgtgccagactcctcccactgctggcgc-----acagccttcagg
A0A8C7G467_BMF-01       t---ttgagccaga---ctcccgctgctggcgc-----acagccttcagg
A0A8C7G467_BMF-02       t---ttgagccaga---ctcccgctgctggcgc-----acagccttcagg
A0A8C7DT45_BAD-02       tttactatatcaga-------ca---gcgagtc-----agagccctcaga
A0A8C7DT45_BAD-01       tttactatatcaga-------ca---gcgagtc-----agagccctcaga
A0A8C7DT45_BAD-03       tttactatatcaga-------ca---gcgagtc-----agagccctcaga
A0A8C7KHU4_BAD-01       catgattgtgtgga-------tgaatgtgagtc-----tgaccactc---
A0A8C7KKS5_BAD-01       ------------ga-------acaagacgagtc-----tgaccactc---
                                                    *   *         *   *   

A0A8C7L4D1_BCL2L11      -----------tcctgcgaaggggaccagcagtcacggggaggaataa--
A0A8C7HIL6_BCL2L11      -----------ttcagcgaaggggagcagcagtcacggggaggaataa--
A0A8C7HIL6_BCL2L11      -----------ttcagcgaaggggagcagcagtcacggggaggaataa--
A0A8C7JEQ7_BMF-01       gaaatcaagtttcatgacagggagagcagggacagagaagacacccagga
A0A8C7JEQ7_BMF-02       gaaatcaagtttcatgacagggagagcagggacagagaagacacccagga
A0A8C7FH91_BMF-01       gaaataaagtacgaggacagaggcacc----------cagacacccagcc
A0A8C7G467_BMF-01       gagataaagtacgaggacaggggaacc----------cagacacccagcc
A0A8C7G467_BMF-02       gagataaagtacgaggacaggggaacc----------cagacacccagcc
A0A8C7DT45_BAD-02       g-----------gaggtaggagaaacc---------gaaaaggaccaatc
A0A8C7DT45_BAD-01       g-----------gaggtaggagaaacc---------gaaaaggaccaatc
A0A8C7DT45_BAD-03       g-----------gaggtaggagaaacc---------gaaaaggaccaatc
A0A8C7KHU4_BAD-01       --------------------aggaacc---------acacacaactca--
A0A8C7KKS5_BAD-01       --------------------aggaacc---------acacactaccca--
                                             *  * *             *         

A0A8C7L4D1_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      --------------------------------------------------
A0A8C7JEQ7_BMF-01       caggtctacacagacgtcgactggacccaacgccattgtcccacggtcag
A0A8C7JEQ7_BMF-02       caggtctacacagacgtcgactggacccaacgccattgtcccacggtcag
A0A8C7FH91_BMF-01       ctgccct------------------------ggcactgcc----------
A0A8C7G467_BMF-01       ctgtcct------------------------gccactgcc----------
A0A8C7G467_BMF-02       ctgtcct------------------------gccactgcc----------
A0A8C7DT45_BAD-02       gtctgccggaaagg------------------------------------
A0A8C7DT45_BAD-01       gtctgccggaaagg------------------------------------
A0A8C7DT45_BAD-03       gtctgccggaaagg------------------------------------
A0A8C7KHU4_BAD-01       --------------------------------------------------
A0A8C7KKS5_BAD-01       --------------------------------------------------
                                                                          

A0A8C7L4D1_BCL2L11      -------------------------------------tgattccgaatag
A0A8C7HIL6_BCL2L11      -------------------------------------tgatgccgaatag
A0A8C7HIL6_BCL2L11      -------------------------------------tgatgccgaatag
A0A8C7JEQ7_BMF-01       agggacacggcatcatggtaccacaaggacacaacaacaacaacaacttt
A0A8C7JEQ7_BMF-02       agggacacggcatcatggtaccacaaggacacaacaacaacaacaacttt
A0A8C7FH91_BMF-01       -------------------------------------caacgacatgctg
A0A8C7G467_BMF-01       -------------------------------------caataatatgctg
A0A8C7G467_BMF-02       -------------------------------------caataatatgctg
A0A8C7DT45_BAD-02       -------------------------------------ggatgactggcgg
A0A8C7DT45_BAD-01       -------------------------------------ggatgactggcgg
A0A8C7DT45_BAD-03       -------------------------------------ggatgactggcgg
A0A8C7KHU4_BAD-01       -----------------------------------------gaatttcag
A0A8C7KKS5_BAD-01       -----------------------------------------gaatttcag
                                                                          

A0A8C7L4D1_BCL2L11      tctgcttggtttccagtcgaggtcgccggtgttcagaacactgtccaggt
A0A8C7HIL6_BCL2L11      tctgcttggtttccagtcgaggtcgccgttgttcagaacactttccaggt
A0A8C7HIL6_BCL2L11      tctgcttggtttccagtcgaggtcgccgttgttcagaacactttccaggt
A0A8C7JEQ7_BMF-01       ccctgtggggtgcaggacaatcaccaggga----agaatactgttccatg
A0A8C7JEQ7_BMF-02       ccctgtggggtgcaggacaatcaccaggga----agaatactgttccatg
A0A8C7FH91_BMF-01       ccctgtggggtg----------gcccaggagcccagaccactcttctacg
A0A8C7G467_BMF-01       ccctgcggggtg----------gcccaggagcccagaccactcttctacg
A0A8C7G467_BMF-02       ccctgcggggtg----------gcccaggagcccagaccactcttctacg
A0A8C7DT45_BAD-02       tccaataggccacgccctcactgtgcctgagatgagactggcaggagagg
A0A8C7DT45_BAD-01       tccaataggccacgccctcactgtgcctgagatgagactggcaggagagg
A0A8C7DT45_BAD-03       tccaataggccacgccctcactgtgcctgagatgagactggcaggagagg
A0A8C7KHU4_BAD-01       ctcc-------atgtctcaactacaatgagcaacagaccaagaccaggtg
A0A8C7KKS5_BAD-01       ctccata----atgtctccgctacgacgagcatcagaccacgaccaggtg
                                                          ***             

A0A8C7L4D1_BCL2L11      cctccagtggatatttttcgttcgacagcgattctattccaag-----ct
A0A8C7HIL6_BCL2L11      catccagtggatatttttcgttcgacagcgattctattccaag-----ct
A0A8C7HIL6_BCL2L11      catccagtggatatttttcgttcgacagcgattctattccaag-----ct
A0A8C7JEQ7_BMF-01       gcaacgctggat--------tccgcttgcact-----tcccag-------
A0A8C7JEQ7_BMF-02       gcaacgctggat--------tccgcttgcact-----tcccag-------
A0A8C7FH91_BMF-01       gcaacgcaggct--------ttcgattgcact-----ttccag-------
A0A8C7G467_BMF-01       gcaacgcaggct--------ttcgattgcact-----ttccag-------
A0A8C7G467_BMF-02       gcaacgcaggct--------ttcgattgcact-----ttccag-------
A0A8C7DT45_BAD-02       g------tcggt--------tgaggatgaactcagagtcccagg------
A0A8C7DT45_BAD-01       g------tcggt--------tgaggatgaactcagagtcccagg------
A0A8C7DT45_BAD-03       g------tcggt--------tgaggatgaactcagagtcccagg------
A0A8C7KHU4_BAD-01       a------gcgag--------tccggctctactcagagtcccaggtgtgct
A0A8C7KKS5_BAD-01       g------gcgag--------ctcggctctactccgagtcccaggtgtgct
                                 *             *       *     * * **       

A0A8C7L4D1_BCL2L11      ccccgctattgaaagataacaagtcgacacagactccgagcccatctagc
A0A8C7HIL6_BCL2L11      ccccgctattgaaagat---aagtcgacacagactccgagcccatctagc
A0A8C7HIL6_BCL2L11      ccccgctattgaaagat---aagtcgacacagactccgagcccatctagc
A0A8C7JEQ7_BMF-01       ctcggttcgagcccatggacgatcggggagagaggcggaac------gag
A0A8C7JEQ7_BMF-02       ctcggttcgagcccatggacgatcggggagagaggcggaac------gag
A0A8C7FH91_BMF-01       cgcggtttgagcaggttggagaccaggg---gcctcaggag------cag
A0A8C7G467_BMF-01       cacagtttgagcgtgttggagaccaggg---gcctctggg----------
A0A8C7G467_BMF-02       cacagtttgagcgtgttggagaccaggg---gcctctggg----------
A0A8C7DT45_BAD-02       cccag---------------------ga---gctccagggt---------
A0A8C7DT45_BAD-01       cccag---------------------ga---gctccagggt---------
A0A8C7DT45_BAD-03       cccag---------------------ga---gctccagggt---------
A0A8C7KHU4_BAD-01       cccaggttggaaaaagggaagacacaga---gtttctggatgtgatgact
A0A8C7KKS5_BAD-01       cccaggttggcagaagggatgacacaga---gtttcaggatgcaataact
                        * * *                          *   * *            

A0A8C7L4D1_BCL2L11      caagtcattacccacgcactgcagcgcatgtctcgagcactggagacccg
A0A8C7HIL6_BCL2L11      caagtcatgactcacgcactgcagcgcatgtctcaagcacaggagaccaa
A0A8C7HIL6_BCL2L11      caagtcatgactcacgcactgcagcgcatgtctcaagcacaggagaccaa
A0A8C7JEQ7_BMF-01       gaggaggag-------------------------gagaggaggag-----
A0A8C7JEQ7_BMF-02       gaggaggag-------------------------gagaggaggag-----
A0A8C7FH91_BMF-01       catcaggtg-------------------------gagagagggag-----
A0A8C7G467_BMF-01       --------a-------------------------gagcgaggggg-----
A0A8C7G467_BMF-02       --------a-------------------------gagcgaggggg-----
A0A8C7DT45_BAD-02       -------ag-------------------------ggggccaggggtggaa
A0A8C7DT45_BAD-01       -------ag-------------------------ggggccaggggtggaa
A0A8C7DT45_BAD-03       -------ag-------------------------ggggccaggggtggaa
A0A8C7KHU4_BAD-01       cctactgag-------------------------gatggcgggggt----
A0A8C7KKS5_BAD-01       cctactgag-------------------------gagggcgggggc----
                                                                 ** *     

A0A8C7L4D1_BCL2L11      gcgagattatgacgtgtggcccaaccccctccggccctatagagcaagcc
A0A8C7HIL6_BCL2L11      tcgagattatgacgcgtggcccaaccccctccacccctatagaccacggc
A0A8C7HIL6_BCL2L11      tcgagattatgacgcgtggcccaaccccctccacccctatagaccacggc
A0A8C7JEQ7_BMF-01       ------------aatggaggag------------------agaccagagg
A0A8C7JEQ7_BMF-02       ------------aatggaggag------------------agaccagagg
A0A8C7FH91_BMF-01       ------------gatggaacggct---------------tcaacagcagc
A0A8C7G467_BMF-01       ------------gatggagcggct---------------caatcggcagc
A0A8C7G467_BMF-02       ------------gatggagcggct---------------caatcggcagc
A0A8C7DT45_BAD-02       ggcatgcccacagacggagcatctttccggggtcgctcccagtcggcccc
A0A8C7DT45_BAD-01       ggcatgcccacagacggagcatctttccggggtcgctcccagtcggcccc
A0A8C7DT45_BAD-03       ggcatgcccacagacggagcatctttccggggtcgctcccagtcggcccc
A0A8C7KHU4_BAD-01       ------------gacggggcttcattccgaggccgatcacagtctgctcc
A0A8C7KKS5_BAD-01       ------------gatggggctcctttccgaagccgatcacagtctgctcc
                                       *                                  

A0A8C7L4D1_BCL2L11      cgccaccgactgcggcggacatgcggccagagatactcatcggtcaggag
A0A8C7HIL6_BCL2L11      caccgtcaactgcaggggacatgtggccagagacactgattggccaggag
A0A8C7HIL6_BCL2L11      caccgtcaactgcaggggacatgtggccagagacactgattggccaggag
A0A8C7JEQ7_BMF-01       aagagcgggtggaggatagcgc------ggaggcgaggatcggacgtaag
A0A8C7JEQ7_BMF-02       aagagcgggtggaggatagcgc------ggaggcgaggatcggacgtaag
A0A8C7FH91_BMF-01       ctcagcagccagcacaaagcat------ggaggtctgcattggacagaaa
A0A8C7G467_BMF-01       cccagctgccagcacgcagcat------agaggtctgcattggacagaaa
A0A8C7G467_BMF-02       cccagctgccagcacgcagcat------agaggtctgcattggacagaaa
A0A8C7DT45_BAD-02       ccctgc--cctctgggcggcca------agagata-----cgggcggcag
A0A8C7DT45_BAD-01       ccctgc--cctctgggcggcca------agagata-----cgggcggcag
A0A8C7DT45_BAD-03       ccctgc--cctctgggcggcca------agagata-----cgggcggcag
A0A8C7KHU4_BAD-01       tcctgc--actgtgggctgcaa------agaaata-----tggctgccag
A0A8C7KKS5_BAD-01       tcctac--actgtgggctgcaa------agaaata-----tggccgccag
                                           *         **          **     * 

A0A8C7L4D1_BCL2L11      cttcagcgcattggagatgagtttaacaacctcttcatacatggg-----
A0A8C7HIL6_BCL2L11      cttcagcgcattggagatgagtttaacgatctcttcatacatggg-----
A0A8C7HIL6_BCL2L11      cttcagcgcattggagatgagtttaacgatctcttcatacatggg-----
A0A8C7JEQ7_BMF-01       ctccgggagatcggagaccagttccaccaggaacatgttcaactg-----
A0A8C7JEQ7_BMF-02       ctccgggagatcggagaccagttccaccaggaacatgttcaactg-----
A0A8C7FH91_BMF-01       ctccaactcatcggagaccagttctaccaagaacaccttcaactg-----
A0A8C7G467_BMF-01       ctccaactcatcggagaccagttccaccaagaacaccttcaagtg-----
A0A8C7G467_BMF-02       ctccaactcatcggagaccagttccaccaagaacaccttcaagtggtgag
A0A8C7DT45_BAD-02       ctccgacgcatgagtgacgagttcga------------------------
A0A8C7DT45_BAD-01       ctccgacgcatgagtgacgagttcga------------------------
A0A8C7DT45_BAD-03       ctccgacgcatgagtgacgagttcga------------------------
A0A8C7KHU4_BAD-01       ctgaggaggatgagtgatgaatttga------------------------
A0A8C7KKS5_BAD-01       ctgaggaggatgagtgatgaatttga------------------------
                        **       **  * **  * **  *                        

A0A8C7L4D1_BCL2L11      --cgccttgcaggcagaaacggtcaggttgcccagggaaacctgcagcag
A0A8C7HIL6_BCL2L11      --cgccttgctggcagaaacggtcatgttgcccaggcaaacctgcaggag
A0A8C7HIL6_BCL2L11      --cgccttgctggcagaaacggtcatgttgcccaggcaaacctgcaggag
A0A8C7JEQ7_BMF-01       --ttcc-tgcggcatcagagggatgt-----------cctaccagtctgg
A0A8C7JEQ7_BMF-02       --ttcc-tgcggcatcagagggatgt-----------cctaccagtctgg
A0A8C7FH91_BMF-01       --tatc-accgaaaccaaaggaacat-----------gaggcccttgtgg
A0A8C7G467_BMF-01       --tatc-accgaaaccaaaggaacat-----------gaggcccttgtgg
A0A8C7G467_BMF-02       aataccaaccgtgactgactgcacagcaca---gctaaagtccactgag-
A0A8C7DT45_BAD-02       --tacgtggctggataaaggggagatgagg---cgggtgaagagtgcggg
A0A8C7DT45_BAD-01       --tacgtggctggataaa-gggaggtgcta---c-tgcaaggtcttccgt
A0A8C7DT45_BAD-03       --tacgtggctggataaaggggagatgagg---cgggtgaagagtgcggg
A0A8C7KHU4_BAD-01       --cacctggctcgacaaaggggagcccaag---agagggattagcccagg
A0A8C7KKS5_BAD-01       --cacctggctcgacaaaggggagcccaag---agagggattagcccagg
                                 *          *                             

A0A8C7L4D1_BCL2L11      atgcaccaagagcccgccttcctactgtggat----ggg-----------
A0A8C7HIL6_BCL2L11      atgcaccaagagcccgccttcctactgtggat----ggg-----------
A0A8C7HIL6_BCL2L11      atgcaccaagagcccgccttcctactgtggat----ggg-----------
A0A8C7JEQ7_BMF-01       attcgtctgaccatggccctctacg---gctt----cct--------gtt
A0A8C7JEQ7_BMF-02       attcgtctgaccatggccctctacg---gctt----cct--------gtt
A0A8C7FH91_BMF-01       tggcgcctggcctcagctctactca---ccct----gct--------gtt
A0A8C7G467_BMF-01       tggcgcctggcctcggctctgctca---ccct----gct--------gtt
A0A8C7G467_BMF-02       ------caggcct--actgtactcagaggtct----gctgagagagagac
A0A8C7DT45_BAD-02       agcagccaaacagatgaccaagtcccccagct----ggt-----------
A0A8C7DT45_BAD-01       tgcagcccaa------atcaaccccctacacttccaggc-----------
A0A8C7DT45_BAD-03       agcagccaaacagatgaccaagtcccccagct----ggt-----------
A0A8C7KHU4_BAD-01       aggaggcaagcagaaagtc---tcccgaggat----ggt-----------
A0A8C7KKS5_BAD-01       aggggtcaagcaggaggtc---tcccggggat----ggt-----------
                              *                        *                  

A0A8C7L4D1_BCL2L11      -------------------------tcttctgattggacg----------
A0A8C7HIL6_BCL2L11      -------------------------gctcctgattggacg----------
A0A8C7HIL6_BCL2L11      -------------------------gctcctgattggacg----------
A0A8C7JEQ7_BMF-01       taacagaga----------------ggcccctgctg--------------
A0A8C7JEQ7_BMF-02       taacagaga----------------ggcccctgctg--------------
A0A8C7FH91_BMF-01       tgagcagga----------------ggccatcgctggaag----------
A0A8C7G467_BMF-01       tgagcagga----------------ggccatcgctggagg----------
A0A8C7G467_BMF-02       tgagcagcagaagtggcttctttacgggcatccattgtggtcatgtctca
A0A8C7DT45_BAD-02       -------------------------gggcctacctgttca----------
A0A8C7DT45_BAD-01       -------------------------ggtccca-------a----------
A0A8C7DT45_BAD-03       -------------------------gggcctacctgttca----------
A0A8C7KHU4_BAD-01       -------------------------tctctttcctctgga----------
A0A8C7KKS5_BAD-01       -------------------------tctctttcctctgga----------
                                                                          

A0A8C7L4D1_BCL2L11      ------actattacagataatcctgcggaga-------------------
A0A8C7HIL6_BCL2L11      ------actattacagatcatcctgcagaga-------------------
A0A8C7HIL6_BCL2L11      ------actattacagatcatcctgcagaga-------------------
A0A8C7JEQ7_BMF-01       -----------------taccccgcctgagag--------gacagga---
A0A8C7JEQ7_BMF-02       -----------------taccccgcctgagag--------gacagga---
A0A8C7FH91_BMF-01       --------------------------ggggag--------agcagggtg-
A0A8C7G467_BMF-01       --------------------------ggggag--------agcagggtg-
A0A8C7G467_BMF-02       gtgtcccgtgtttgttttggctagtcagtgagcatgcattagcccagtgt
A0A8C7DT45_BAD-02       -------------gtcataaggagacagagagatggagaagggagaggat
A0A8C7DT45_BAD-01       -------------ttcat--------------------------------
A0A8C7DT45_BAD-03       -------------gtcataaggagacagagacagaacata----------
A0A8C7KHU4_BAD-01       -------------gtccaaaggaggcggaaggcagg--------------
A0A8C7KKS5_BAD-01       -------------gtccaaacgaggccgaaggcagg--------------
                                                                          

A0A8C7L4D1_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      --------------------------------------------------
A0A8C7HIL6_BCL2L11      --------------------------------------------------
A0A8C7JEQ7_BMF-01       --------------------------a-----------------------
A0A8C7JEQ7_BMF-02       --------------------------a-----------------------
A0A8C7FH91_BMF-01       --------------------------g-----------------------
A0A8C7G467_BMF-01       --------------------------g-----------------------
A0A8C7G467_BMF-02       tctgacctctcattctacccccccaag-----------------------
A0A8C7DT45_BAD-02       tggaaggcgggggggatgggcctacctgttctctcaccaagagacaaccc
A0A8C7DT45_BAD-01       ----------------------tccctatcccctc---------------
A0A8C7DT45_BAD-03       ----------------------cccctatcatccc---------------
A0A8C7KHU4_BAD-01       --------------------------------------------------
A0A8C7KKS5_BAD-01       --------------------------------------------------
                                                                          

A0A8C7L4D1_BCL2L11      -----------------------------------agatga---------
A0A8C7HIL6_BCL2L11      -----------------------------------agatga---------
A0A8C7HIL6_BCL2L11      -----------------------------------agatga---------
A0A8C7JEQ7_BMF-01       -----------------------------------agatga---------
A0A8C7JEQ7_BMF-02       -----------------------------------agatga---------
A0A8C7FH91_BMF-01       -----------------------------------aggtga---------
A0A8C7G467_BMF-01       -----------------------------------aggtga---------
A0A8C7G467_BMF-02       -----------------------------------acgtag---------
A0A8C7DT45_BAD-02       accgtaatcgtaccactattgaaccacggtcatcagagtacagagaaggg
A0A8C7DT45_BAD-01       ----------------------gatgttaggggctggatag---------
A0A8C7DT45_BAD-03       ----------------------accacgatcatctgagtag---------
A0A8C7KHU4_BAD-01       -----------------------------------gagtga---------
A0A8C7KKS5_BAD-01       -----------------------------------gagtga---------
                                                              *           

A0A8C7L4D1_BCL2L11      ------------------------------
A0A8C7HIL6_BCL2L11      ------------------------------
A0A8C7HIL6_BCL2L11      ------------------------------
A0A8C7JEQ7_BMF-01       ------------------------------
A0A8C7JEQ7_BMF-02       ------------------------------
A0A8C7FH91_BMF-01       ------------------------------
A0A8C7G467_BMF-01       ------------------------------
A0A8C7G467_BMF-02       ------------------------------
A0A8C7DT45_BAD-02       gatgtttcccatgccaataaagccccttga
A0A8C7DT45_BAD-01       ------------------------------
A0A8C7DT45_BAD-03       ------------------------------
A0A8C7KHU4_BAD-01       ------------------------------
A0A8C7KKS5_BAD-01       ------------------------------
                                                      

© 1998-2022Legal notice