Dataset for CDS BMF of organism Oncorhynchus kisutch

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A8C7FH91_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Oncorhynchus kisutch GN=BMF (length=495 residues).
atggatgatgaggaggatgatgtgtttgtgccagactcctcccactgctggcgcacagccttcagggaaataaagtacga
ggacagaggcacccagacacccagccctgccctggcactgcccaacgacatgctgccctgtggggtggcccaggagccca
gaccactcttctacggcaacgcaggctttcgattgcactttccagcgcggtttgagcaggttggagaccaggggcctcag
gagcagcatcaggtggagagagggaggatggaacggcttcaacagcagcctcagcagccagcacaaagcatggaggtctg
cattggacagaaactccaactcatcggagaccagttctaccaagaacaccttcaactgtatcaccgaaaccaaaggaaca
tgaggcccttgtggtggcgcctggcctcagctctactcaccctgctgtttgagcaggaggccatcgctggaagggggaga
gcagggtggaggtga
>gnl|bcl2dbcds|A0A8C7G467_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Oncorhynchus kisutch GN=BMF (length=480 residues).
atggacgatgaggaggatgatgtgtttgagccagactcccgctgctggcgcacagccttcagggagataaagtacgagga
caggggaacccagacacccagccctgtcctgccactgcccaataatatgctgccctgcggggtggcccaggagcccagac
cactcttctacggcaacgcaggctttcgattgcactttccagcacagtttgagcgtgttggagaccaggggcctctggga
gagcgaggggggatggagcggctcaatcggcagccccagctgccagcacgcagcatagaggtctgcattggacagaaact
ccaactcatcggagaccagttccaccaagaacaccttcaagtgtatcaccgaaaccaaaggaacatgaggcccttgtggt
ggcgcctggcctcggctctgctcaccctgctgtttgagcaggaggccatcgctggaggggggagagcagggtggaggtga
>gnl|bcl2dbcds|A0A8C7G467_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Oncorhynchus kisutch GN=BMF (length=585 residues).
atggacgatgaggaggatgatgtgtttgagccagactcccgctgctggcgcacagccttcagggagataaagtacgagga
caggggaacccagacacccagccctgtcctgccactgcccaataatatgctgccctgcggggtggcccaggagcccagac
cactcttctacggcaacgcaggctttcgattgcactttccagcacagtttgagcgtgttggagaccaggggcctctggga
gagcgaggggggatggagcggctcaatcggcagccccagctgccagcacgcagcatagaggtctgcattggacagaaact
ccaactcatcggagaccagttccaccaagaacaccttcaagtggtgagaataccaaccgtgactgactgcacagcacagc
taaagtccactgagcaggcctactgtactcagaggtctgctgagagagagactgagcagcagaagtggcttctttacggg
catccattgtggtcatgtctcagtgtcccgtgtttgttttggctagtcagtgagcatgcattagcccagtgttctgacct
ctcattctacccccccaagacgtag
>gnl|bcl2dbcds|A0A8C7JEQ7_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Oncorhynchus kisutch GN=BMF (length=588 residues).
atggatgatgaagaggaggacatgtctcttcagcgtcctgtctcccagtgctggggcacccccttcagggaaatcaagtt
tcatgacagggagagcagggacagagaagacacccaggacaggtctacacagacgtcgactggacccaacgccattgtcc
cacggtcagagggacacggcatcatggtaccacaaggacacaacaacaacaacaactttccctgtggggtgcaggacaat
caccagggaagaatactgttccatggcaacgctggattccgcttgcacttcccagctcggttcgagcccatggacgatcg
gggagagaggcggaacgaggaggaggaggagaggaggagaatggaggagagaccagaggaagagcgggtggaggatagcg
cggaggcgaggatcggacgtaagctccgggagatcggagaccagttccaccaggaacatgttcaactgttcctgcggcat
cagagggatgtcctaccagtctggattcgtctgaccatggccctctacggcttcctgtttaacagagaggcccctgctgt
accccgcctgagaggacaggaaagatga
>gnl|bcl2dbcds|A0A8C7JEQ7_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Oncorhynchus kisutch GN=BMF (length=699 residues).
atgagggggacatgtctctctgtctctctctcaaacagactcacacacacttctgtctcacaccatttctcctgtctctc
tcctgtagggagactacctctgagactcccaatggatgatgaagaggaggacatgtctcttcagcgtcctgtctcccagt
gctggggcacccccttcagggaaatcaagtttcatgacagggagagcagggacagagaagacacccaggacaggtctaca
cagacgtcgactggacccaacgccattgtcccacggtcagagggacacggcatcatggtaccacaaggacacaacaacaa
caacaactttccctgtggggtgcaggacaatcaccagggaagaatactgttccatggcaacgctggattccgcttgcact
tcccagctcggttcgagcccatggacgatcggggagagaggcggaacgaggaggaggaggagaggaggagaatggaggag
agaccagaggaagagcgggtggaggatagcgcggaggcgaggatcggacgtaagctccgggagatcggagaccagttcca
ccaggaacatgttcaactgttcctgcggcatcagagggatgtcctaccagtctggattcgtctgaccatggccctctacg
gcttcctgtttaacagagaggcccctgctgtaccccgcctgagaggacaggaaagatga
© 1998-2022Legal notice