Dataset for CDS BMF of organism Oncorhynchus kisutch

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C7JEQ7_BMF-01      --------------------------------------------------
A0A8C7JEQ7_BMF-02      atgagggggacatgtctctctgtctctctctcaaacagactcacacacac
A0A8C7FH91_BMF-01      --------------------------------------------------
A0A8C7G467_BMF-01      --------------------------------------------------
A0A8C7G467_BMF-02      --------------------------------------------------
                                                                         

A0A8C7JEQ7_BMF-01      --------------------------------------------------
A0A8C7JEQ7_BMF-02      ttctgtctcacaccatttctcctgtctctctcctgtagggagactacctc
A0A8C7FH91_BMF-01      --------------------------------------------------
A0A8C7G467_BMF-01      --------------------------------------------------
A0A8C7G467_BMF-02      --------------------------------------------------
                                                                         

A0A8C7JEQ7_BMF-01      -----------atggatgatgaagaggaggacatgtctcttcagcgtcct
A0A8C7JEQ7_BMF-02      tgagactcccaatggatgatgaagaggaggacatgtctcttcagcgtcct
A0A8C7FH91_BMF-01      -----------atggatgatgaggaggatgatgtgt---ttgtgccagac
A0A8C7G467_BMF-01      -----------atggacgatgaggaggatgatgtgt---ttgagccaga-
A0A8C7G467_BMF-02      -----------atggacgatgaggaggatgatgtgt---ttgagccaga-
                                  ***** ***** ***** **  ***   **  **     

A0A8C7JEQ7_BMF-01      gtctcccagtgctggggcacccccttcagggaaatcaagtttcatgacag
A0A8C7JEQ7_BMF-02      gtctcccagtgctggggcacccccttcagggaaatcaagtttcatgacag
A0A8C7FH91_BMF-01      tcctcccactgctggcgcacagccttcagggaaataaagtacgaggacag
A0A8C7G467_BMF-01      --ctcccgctgctggcgcacagccttcagggagataaagtacgaggacag
A0A8C7G467_BMF-02      --ctcccgctgctggcgcacagccttcagggagataaagtacgaggacag
                         *****  ****** ****  ********** ** ****   * *****

A0A8C7JEQ7_BMF-01      ggagagcagggacagagaagacacccaggacaggtctacacagacgtcga
A0A8C7JEQ7_BMF-02      ggagagcagggacagagaagacacccaggacaggtctacacagacgtcga
A0A8C7FH91_BMF-01      aggcacc----------cagacacccagccctgccct-------------
A0A8C7G467_BMF-01      gggaacc----------cagacacccagccctgtcct-------------
A0A8C7G467_BMF-02      gggaacc----------cagacacccagccctgtcct-------------
                        *  * *           **********  * *  **             

A0A8C7JEQ7_BMF-01      ctggacccaacgccattgtcccacggtcagagggacacggcatcatggta
A0A8C7JEQ7_BMF-02      ctggacccaacgccattgtcccacggtcagagggacacggcatcatggta
A0A8C7FH91_BMF-01      -----------ggcactgcc------------------------------
A0A8C7G467_BMF-01      -----------gccactgcc------------------------------
A0A8C7G467_BMF-02      -----------gccactgcc------------------------------
                                  * ** ** *                              

A0A8C7JEQ7_BMF-01      ccacaaggacacaacaacaacaacaactttccctgtggggtgcaggacaa
A0A8C7JEQ7_BMF-02      ccacaaggacacaacaacaacaacaactttccctgtggggtgcaggacaa
A0A8C7FH91_BMF-01      -----------------caacgacatgctgccctgtggggtg--------
A0A8C7G467_BMF-01      -----------------caataatatgctgccctgcggggtg--------
A0A8C7G467_BMF-02      -----------------caataatatgctgccctgcggggtg--------
                                        ***  * *   * ***** ******        

A0A8C7JEQ7_BMF-01      tcaccaggga----agaatactgttccatggcaacgctggattccgcttg
A0A8C7JEQ7_BMF-02      tcaccaggga----agaatactgttccatggcaacgctggattccgcttg
A0A8C7FH91_BMF-01      --gcccaggagcccagaccactcttctacggcaacgcaggctttcgattg
A0A8C7G467_BMF-01      --gcccaggagcccagaccactcttctacggcaacgcaggctttcgattg
A0A8C7G467_BMF-02      --gcccaggagcccagaccactcttctacggcaacgcaggctttcgattg
                          **  ***    ***  *** *** * ******** ** ** ** ***

A0A8C7JEQ7_BMF-01      cacttcccagctcggttcgagcccatggacgatcggggagagaggcggaa
A0A8C7JEQ7_BMF-02      cacttcccagctcggttcgagcccatggacgatcggggagagaggcggaa
A0A8C7FH91_BMF-01      cactttccagcgcggtttgagcaggttggagaccaggg---gcctcagga
A0A8C7G467_BMF-01      cactttccagcacagtttgagcgtgttggagaccaggg---gcctctggg
A0A8C7G467_BMF-02      cactttccagcacagtttgagcgtgttggagaccaggg---gcctctggg
                       ***** ***** * *** ****   * *  ** * ***   *   * *  

A0A8C7JEQ7_BMF-01      cgaggaggaggaggagaggaggagaatggaggag---agaccagaggaag
A0A8C7JEQ7_BMF-02      cgaggaggaggaggagaggaggagaatggaggag---agaccagaggaag
A0A8C7FH91_BMF-01      gcagcatcaggtggagagagggaggatggaacggcttcaacagcagcctc
A0A8C7G467_BMF-01      ------------agagcgaggggggatggagcggctcaatcggcagcccc
A0A8C7G467_BMF-02      ------------agagcgaggggggatggagcggctcaatcggcagcccc
                                    *** *  ** * *****   *      *   **    

A0A8C7JEQ7_BMF-01      agcgggtggaggatagcgcggaggcgaggatcggacgtaagctccgggag
A0A8C7JEQ7_BMF-02      agcgggtggaggatagcgcggaggcgaggatcggacgtaagctccgggag
A0A8C7FH91_BMF-01      agcagccagcacaaagcatggaggtctgcattggacagaaactccaactc
A0A8C7G467_BMF-01      agctgccagcacgcagcatagaggtctgcattggacagaaactccaactc
A0A8C7G467_BMF-02      agctgccagcacgcagcatagaggtctgcattggacagaaactccaactc
                       *** *   *     ***   ****   * ** ****  ** ****     

A0A8C7JEQ7_BMF-01      atcggagaccagttccaccaggaacatgttcaactg-------ttcc-tg
A0A8C7JEQ7_BMF-02      atcggagaccagttccaccaggaacatgttcaactg-------ttcc-tg
A0A8C7FH91_BMF-01      atcggagaccagttctaccaagaacaccttcaactg-------tatc-ac
A0A8C7G467_BMF-01      atcggagaccagttccaccaagaacaccttcaagtg-------tatc-ac
A0A8C7G467_BMF-02      atcggagaccagttccaccaagaacaccttcaagtggtgagaataccaac
                       *************** **** *****  ***** **       *  *   

A0A8C7JEQ7_BMF-01      cggcatcagagggatgt--------cctaccagtctggattcgtctgacc
A0A8C7JEQ7_BMF-02      cggcatcagagggatgt--------cctaccagtctggattcgtctgacc
A0A8C7FH91_BMF-01      cgaaaccaaaggaacat--------gaggcccttgtggtggcgcctggcc
A0A8C7G467_BMF-01      cgaaaccaaaggaacat--------gaggcccttgtggtggcgcctggcc
A0A8C7G467_BMF-02      cgtgactgactgcacagcacagctaaagtccactgag-------caggcc
                       **  *      * *               **  *  *       * * **

A0A8C7JEQ7_BMF-01      atggccctctacg---gcttcct--------gtttaacagaga-------
A0A8C7JEQ7_BMF-02      atggccctctacg---gcttcct--------gtttaacagaga-------
A0A8C7FH91_BMF-01      tcagctctactca---ccctgct--------gtttgagcagga-------
A0A8C7G467_BMF-01      tcggctctgctca---ccctgct--------gtttgagcagga-------
A0A8C7G467_BMF-02      t--actgtactcagaggtctgctgagagagagactgagcagcagaagtgg
                           *  *   *       * **        *  * *     *       

A0A8C7JEQ7_BMF-01      ---------ggcccctgctg------------------------------
A0A8C7JEQ7_BMF-02      ---------ggcccctgctg------------------------------
A0A8C7FH91_BMF-01      ---------ggccatcgctggaag--------------------------
A0A8C7G467_BMF-01      ---------ggccatcgctggagg--------------------------
A0A8C7G467_BMF-02      cttctttacgggcatccattgtggtcatgtctcagtgtcccgtgtttgtt
                                ** *     *                               

A0A8C7JEQ7_BMF-01      -taccccgcctgagag--------gacagga-------------------
A0A8C7JEQ7_BMF-02      -taccccgcctgagag--------gacagga-------------------
A0A8C7FH91_BMF-01      ----------ggggag--------agcagggtg-----------------
A0A8C7G467_BMF-01      ----------ggggag--------agcagggtg-----------------
A0A8C7G467_BMF-02      ttggctagtcagtgagcatgcattagcccagtgttctgacctctcattct
                                  * ***          *                       

A0A8C7JEQ7_BMF-01      ----------aagatga
A0A8C7JEQ7_BMF-02      ----------aagatga
A0A8C7FH91_BMF-01      ----------gaggtga
A0A8C7G467_BMF-01      ----------gaggtga
A0A8C7G467_BMF-02      acccccccaagacgtag
                                  *  *  

© 1998-2022Legal notice