Dataset for CDS BCL2L11 of organism Nomascus leucogenys

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A2I3GVB2_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A2I3GVB2_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L11 (length=279 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgaggccgctggatcctccctcgaa
gttcagtggccattcgagtggttagcaaaatcaagctaa
© 1998-2020Legal notice