Dataset for CDS BCL2L11 of organism Nomascus leucogenys

[Download (right click)] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A2I3GAA1_BCL2L11-02      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3GAA1_BCL2L11-08      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3GAA1_BCL2L11-06      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3GAA1_BCL2L11-04      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3GAA1_BCL2L11-01      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3GAA1_BCL2L11-05      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3GAA1_BCL2L11-07      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3GAA1_BCL2L11-03      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
                           **************************************************

A0A2I3GAA1_BCL2L11-02      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3GAA1_BCL2L11-08      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3GAA1_BCL2L11-06      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3GAA1_BCL2L11-04      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3GAA1_BCL2L11-01      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3GAA1_BCL2L11-05      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3GAA1_BCL2L11-07      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3GAA1_BCL2L11-03      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
                           **************************************************

A0A2I3GAA1_BCL2L11-02      cctccctacagacagagccacaag--------------------------
A0A2I3GAA1_BCL2L11-08      cctccctacagacagagccacaag--------------------------
A0A2I3GAA1_BCL2L11-06      cctccctacagacagagccacaagctt-----------------------
A0A2I3GAA1_BCL2L11-04      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I3GAA1_BCL2L11-01      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I3GAA1_BCL2L11-05      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I3GAA1_BCL2L11-07      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I3GAA1_BCL2L11-03      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
                           ************************                          

A0A2I3GAA1_BCL2L11-02      --------------------------------------------------
A0A2I3GAA1_BCL2L11-08      --------------------------------------------------
A0A2I3GAA1_BCL2L11-06      --------------------------------------------------
A0A2I3GAA1_BCL2L11-04      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2I3GAA1_BCL2L11-01      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2I3GAA1_BCL2L11-05      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2I3GAA1_BCL2L11-07      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2I3GAA1_BCL2L11-03      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
                                                                             

A0A2I3GAA1_BCL2L11-02      --------------------------------------------------
A0A2I3GAA1_BCL2L11-08      --------------------------------------------------
A0A2I3GAA1_BCL2L11-06      --------------------------------------------------
A0A2I3GAA1_BCL2L11-04      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2I3GAA1_BCL2L11-01      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2I3GAA1_BCL2L11-05      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2I3GAA1_BCL2L11-07      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2I3GAA1_BCL2L11-03      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
                                                                             

A0A2I3GAA1_BCL2L11-02      --------------------------------------------------
A0A2I3GAA1_BCL2L11-08      --------------------------------------------------
A0A2I3GAA1_BCL2L11-06      --------------------------------------------------
A0A2I3GAA1_BCL2L11-04      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2I3GAA1_BCL2L11-01      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2I3GAA1_BCL2L11-05      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2I3GAA1_BCL2L11-07      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2I3GAA1_BCL2L11-03      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
                                                                             

A0A2I3GAA1_BCL2L11-02      ----acaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3GAA1_BCL2L11-08      ----acaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3GAA1_BCL2L11-06      --------------------------------------------------
A0A2I3GAA1_BCL2L11-04      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3GAA1_BCL2L11-01      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3GAA1_BCL2L11-05      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3GAA1_BCL2L11-07      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3GAA1_BCL2L11-03      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                                                                             

A0A2I3GAA1_BCL2L11-02      aagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtca
A0A2I3GAA1_BCL2L11-08      aagtcctccttgccaggccttcaaccactatctcagtgcaatggatgagg
A0A2I3GAA1_BCL2L11-06      -----------------------------------------------cca
A0A2I3GAA1_BCL2L11-04      aagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
A0A2I3GAA1_BCL2L11-01      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2I3GAA1_BCL2L11-05      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2I3GAA1_BCL2L11-07      aagtcctccttgccaggccttcaaccactatctcagtgcaatggctaac-
A0A2I3GAA1_BCL2L11-03      aagtcctccttgccaggccttcaaccactatctcagtgcaatgggtatt-
                                                                             

A0A2I3GAA1_BCL2L11-02      tcctagaggatgtaggtg---atatt-tcactgtggtttggatttatatt
A0A2I3GAA1_BCL2L11-08      -----ccgctggatcctccctcgaagttcagtggccattc----------
A0A2I3GAA1_BCL2L11-06      tgaggcaggctgaacctgcagatatgcgcccggagatatggattgcccaa
A0A2I3GAA1_BCL2L11-04      aaatagaggaa---------------------------------------
A0A2I3GAA1_BCL2L11-01      tgaggcaggctgaacctgcagatatgcgcccggagatatggattgcccaa
A0A2I3GAA1_BCL2L11-05      tgaggcaggctgaacctgcagatatgcgcccggagatatggattgcccaa
A0A2I3GAA1_BCL2L11-07      --------------------------------------------------
A0A2I3GAA1_BCL2L11-03      --------------------------------------------------
                                                                             

A0A2I3GAA1_BCL2L11-02      tactggcttagatttgtatggccaccaccatagtcaagatacagaacaat
A0A2I3GAA1_BCL2L11-08      --------------------------------------------------
A0A2I3GAA1_BCL2L11-06      gagttgcggcgtat--------------cggagacgagtttaacgcttac
A0A2I3GAA1_BCL2L11-04      --------------------------------------------------
A0A2I3GAA1_BCL2L11-01      gagttgcggcgtat--------------cggagacgagtttaacgcttac
A0A2I3GAA1_BCL2L11-05      gagttgcggcgtat--------------cggagacgagtttaacgcttac
A0A2I3GAA1_BCL2L11-07      --------------------------------------------------
A0A2I3GAA1_BCL2L11-03      --------------------------------------------------
                                                                             

A0A2I3GAA1_BCL2L11-02      tcaaccaca-----------------------------------------
A0A2I3GAA1_BCL2L11-08      --------------------------------------------------
A0A2I3GAA1_BCL2L11-06      tatgcaaggaggctggca--------------------------------
A0A2I3GAA1_BCL2L11-04      --------------------------------------------------
A0A2I3GAA1_BCL2L11-01      tatgcaaggagggtatttttgaataattaccaagcagccgaagaccaccc
A0A2I3GAA1_BCL2L11-05      tatgcaaggaggttag----------------------------------
A0A2I3GAA1_BCL2L11-07      --------------------------------------------------
A0A2I3GAA1_BCL2L11-03      --------------------------------------------------
                                                                             

A0A2I3GAA1_BCL2L11-02      ------------------------------------------------ag
A0A2I3GAA1_BCL2L11-08      --------------------------------------gagtggttagca
A0A2I3GAA1_BCL2L11-06      --------------------------------------aaactcctggca
A0A2I3GAA1_BCL2L11-04      --------------------------------------------------
A0A2I3GAA1_BCL2L11-01      acgaatggttatcttacgactgttacgttacattgtccgcctggtgtgga
A0A2I3GAA1_BCL2L11-05      --------------------------------------------------
A0A2I3GAA1_BCL2L11-07      --------------------------------------------------
A0A2I3GAA1_BCL2L11-03      --------------------------------------------------
                                                                             

A0A2I3GAA1_BCL2L11-02      gatttctcatga
A0A2I3GAA1_BCL2L11-08      aaatcaagctaa
A0A2I3GAA1_BCL2L11-06      tcctccacctga
A0A2I3GAA1_BCL2L11-04      gttgtcgtgtag
A0A2I3GAA1_BCL2L11-01      ga-atgcattga
A0A2I3GAA1_BCL2L11-05      ----agaaatag
A0A2I3GAA1_BCL2L11-07      ---tgggactag
A0A2I3GAA1_BCL2L11-03      ---tttgaataa
                                    *  

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice