Dataset for CDS BCL2L11 of organism Nomascus leucogenys

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I3GVB2_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2I3GVB2_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
                        **************************************************

A0A2I3GVB2_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2I3GVB2_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
                        **************************************************

A0A2I3GVB2_BCL2L11      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
A0A2I3GVB2_BCL2L11      cctccctacagacagagccaca----------------------------
                        **********************                            

A0A2I3GVB2_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2I3GVB2_BCL2L11      --------------------------------------------------
                                                                          

A0A2I3GVB2_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2I3GVB2_BCL2L11      --------------------------------------------------
                                                                          

A0A2I3GVB2_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2I3GVB2_BCL2L11      --------------------------------------------------
                                                                          

A0A2I3GVB2_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2I3GVB2_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                          ************************************************

A0A2I3GVB2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggctaa--
A0A2I3GVB2_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggatgagg
                        ******************************************** * *  

A0A2I3GVB2_BCL2L11      ---ctgg-------------------------------------------
A0A2I3GVB2_BCL2L11      ccgctggatcctccctcgaagttcagtggccattcgagtggttagcaaaa
                           ****                                           

A0A2I3GVB2_BCL2L11      ---gactag
A0A2I3GVB2_BCL2L11      tcaagctaa
                             *** 

© 1998-2020Legal notice