Dataset for CDS classical BH3-containing proteins of organism Nannospalax galili

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|A0A8C6Q939_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Nannospalax galili GN=BIK (length=453 residues).
atgtcagagacaagacccatggccaggggcctcttcatcgagacactgctgcaggagcagctccttctgcctccagtggc
ccctggggctccaggaatgacagagcctgtgggagaagtggacctcatggagtgcctggagggcagtaaccaggtggccc
tgcggctggcctgcattggagatgagatggatctgcaccttcggagcccccatctgacccagctgcccgggattgccatg
cacagcctggctgtcacctacagacaaacaggcattaggggtgtcctcagaagcttgacccacagcctctgcagccttgg
agagagcatatggtcctggagattcctgactcctgtcatctgggtgtcacctgaccaggcctgcaggcagctgctgccct
tggtcttgctggtcctgctgctgggcggggccctgcacctgctgcctcagtga
>gnl|bcl2dbcds|A0A8C6Q9N0_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Nannospalax galili GN=BAD (length=609 residues).
atgggaaccccaaagaggccctcgctagctcctgcacacgcccgaggcgtgaggaagtctgagtccagcatccggagcct
ggggagcgacgcgggaggaaggcggtggcgaccagcagcccagagcatgttccagatcccagagtttgagccgagtgagc
aggaagactgcagctctgcagaaaggagcctggggcctgtcctggctggggaccagtcaggtctctgcccggccccaggt
ctcctaggggacaccagtcaccagcagaggggtgcgaccaacagcagccatcatggaggcgctggggctgagacccggag
tcgtcacagttcgtaccccgcggggacggacgaggatgaaaggatcgaggaggaactcagccccttccggggccgctcgc
gctcggctccccccaacctctgggccgcacagcgctacggccgcgagctccggaggatgagtgacgagttccagggctcc
ttcaagggccttcctcgcccaaagagcgcgggcacggcgacacagatgcggcaaagctccagctggacgcgaatcttcca
gtcctggtgggatcgaaacttggggaaaggaggctccgccccctcttaa
>gnl|bcl2dbcds|A0A8C6QGZ2_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Nannospalax galili GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagttctccggagcccgtagagggcctggcccgcgatggcccacgtcccttcccgct
cggtcgcctgatgccatcggctgtgtcctgcggcctctgtgagccgggcctgcccgccgcccccgccgcccctgccctgc
tgcccgccgcctacctctgcgcccccaccgcccagcctgccgtcaccgccgccctggggggcccccgctggcctggggct
ccccgcagccggccccgaggcccgcgcccggatggtcctcagccctcgctctcaccggccgagcagcacctagagtctac
cgtgcccagcgccccggaggccctggcaggaggtcccacccaggcagccccgggagtccgaggggaggaggaggagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagactagaagaacaa
catcgacaccgcccctcgccctggagggccatatacaatctcttcatgggactcctgcccttacccagggaccccagagc
cccagagatggagcccaactag
>gnl|bcl2dbcds|A0A8C6QXX9_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Nannospalax galili GN=BCL2L11 (length=591 residues).
atggccaagcaaccttccgatgtaagttctgagtgtgacagagagggtggacaattgcagcctgctgagaggcctgccca
gctcaggcctggggcacctacctccctccagacagaacagcaaggtaatcccgaaggcgaaggggaccgctgcccccacg
gcagccctcagggcccgctggccccaccggccagccctgggccttttgctaccagatccccgcttttcatctttgtgaga
agatcttctctgctgtcccgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcgatggcttctataaggcagtctc
aggaggaacctgcagatatacgccccgaaatatggattgcacaggagctgcggcggattggagatgaatttaacgcctct
tacccaaggagggtatttttgaataattaccaagcagatgaagaccacccccaaatggttatcttacaactgttacgttt
catcgtccgcctggtgtggagaaggcattga
>gnl|bcl2dbcds|A0A8C6QXX9_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Nannospalax galili GN=BCL2L11 (length=423 residues).
atggccaagcaaccttccgatgtaagttctgagtgtgacagagagggtggacaattgcagcctgctgagaggcctgccca
gctcaggcctggggcacctacctccctccagacagaacagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcgatggcttctataaggcagtctcaggaggaa
cctgcagatatacgccccgaaatatggattgcacaggagctgcggcggattggagatgaatttaacgcctcttacccaag
gagggtatttttgaataattaccaagcagatgaagaccacccccaaatggttatcttacaactgttacgtttcatcgtcc
gcctggtgtggagaaggcattga
>gnl|bcl2dbcds|A0A8C6QXX9_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Nannospalax galili GN=BCL2L11 (length=255 residues).
atggccaagcaaccttccgatgtaagttctgagtgtgacagagagggtggacaattgcagcctgctgagaggcctgccca
gctcaggcctggggcacctacctccctccagacagaacagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcgatggagctaaaaaacttgaatctctgcagc
cttcaagctaaataa
>gnl|bcl2dbcds|A0A8C6R2L6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Nannospalax galili GN=BMF (length=765 residues).
atgccccgagcgggcgtattttggaaacaataccgcgcgctgagccgtggcctcctcccgcgccagctcgtgccggcagc
cgccgctgccgcaccctgcgccacccgcctcccgccgcacccccgattgctcgtcacgctggaccctggtgcagagccct
ggcatcacgactcggaagctgagactcactcctggagtcacccaggagaaatggagccacctcagtgtgtggaggagctg
gaagatgatgtgtttcagccagaagatggggagccagggacacagtctgggagtttgctctctgctgacctgtttgccca
gagccagctggattgccccctcagccggcttcagctcttccctcttacccactgctgtggccctgggctccggcccatta
gccaggaagacaaggccactcagaccctcagtccagcctccccaagccagggtgtcatgctgccttgtggggtgacagag
gaaccccaacgactcttttacggcaatgctggctaccgacttcctctccctaccagtttccctgcaggcttgccccttgg
ggagcaggctcctgaagggcagtggcaacatcgagccgaggtacagatcgccagaaagcttcagtgcattgcagaccagt
tccaccggctccatatgcagcaataccagcagaaccgagaccgagcatggtggcaggtcttcctattcctgcacaacctg
gccttgaacagagaaggaaacagggatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A8C6R2L6_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Nannospalax galili GN=BMF (length=570 residues).
attttcccaggagaaatggagccacctcagtgtgtggaggagctggaagatgatgtgtttcagccagaagatggggagcc
agggacacagtctgggagtttgctctctgctgacctgtttgcccagagccagctggattgccccctcagccggcttcagc
tcttccctcttacccactgctgtggccctgggctccggcccattagccaggaagacaaggccactcagaccctcagtcca
gcctccccaagccagggtgtcatgctgccttgtggggtgacagaggaaccccaacgactcttttacggcaatgctggcta
ccgacttcctctccctaccagtttccctgcaggcttgccccttggggagcaggctcctgaagggcagtggcaacatcgag
ccgaggtacagatcgccagaaagcttcagtgcattgcagaccagttccaccggctccatatgcagcaataccagcagaac
cgagaccgagcatggtggcaggtcttcctattcctgcacaacctggccttgaacagagaaggaaacagggatggggcagg
tcccaggtga
>gnl|bcl2dbcds|A0A8C6RUL4_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Nannospalax galili GN=PMAIP1 (length=315 residues).
atgcccgggagcgaggcgcgtcagagcgcgccatcgaacgccacgcgggcagagctagagttggagtgtgccgctcagct
taggagaattggagataaactgaattccactgggcgtgctgctgacatcacagcagtgctagcagagatgcccggaaaga
aggctcggaagagcgcgcagcggagcccgagccctgcgcggttgccggcagatctggaagctgagtgcgctcaactgaga
agaattggagacaaactgaactttcggcagaaacttctgaatttgttctccaaactctttaatttaataacctga
© 1998-2022Legal notice