Dataset for CDS classical BH3-containing proteins of organism Nannospalax galili

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6RUL4_PMAIP1-      -----------------atg------------------------------
A0A8C6QXX9_BCL2L11      -----------------atg------------------------------
A0A8C6QXX9_BCL2L11      -----------------atg------------------------------
A0A8C6QXX9_BCL2L11      -----------------atg------------------------------
A0A8C6Q9N0_BAD-01       -----------------atgggaaccccaa--------------------
A0A8C6QGZ2_BBC3-01      -----------------at-------------------------------
A0A8C6Q939_BIK-01       -----------------atgtcagagacaagacc-----catggccaggg
A0A8C6R2L6_BMF-01       atgccccgagcgggcgtattttggaaacaataccgcgcgctgagccgtgg
A0A8C6R2L6_BMF-02       -----------------atttt----------------------------
                                         **                               

A0A8C6RUL4_PMAIP1-      --------------------------------------------------
A0A8C6QXX9_BCL2L11      --------------------------------------------------
A0A8C6QXX9_BCL2L11      --------------------------------------------------
A0A8C6QXX9_BCL2L11      --------------------------------------------------
A0A8C6Q9N0_BAD-01       ---------------------------agaggccctcgctagctcctgca
A0A8C6QGZ2_BBC3-01      --------------------------------------------------
A0A8C6Q939_BIK-01       gcctcttcatcgagacactgctgcaggagcagctccttctgcctccag--
A0A8C6R2L6_BMF-01       cctcctcccgcgccagctcgtgccggcagccgccgctgccgcaccctgcg
A0A8C6R2L6_BMF-02       --------------------------------------------------
                                                                          

A0A8C6RUL4_PMAIP1-      --------------------------------------------------
A0A8C6QXX9_BCL2L11      --------------------------------------------------
A0A8C6QXX9_BCL2L11      --------------------------------------------------
A0A8C6QXX9_BCL2L11      --------------------------------------------------
A0A8C6Q9N0_BAD-01       cac--------------------------------------gcccgaggc
A0A8C6QGZ2_BBC3-01      -----------------------------------------ggcccgcgc
A0A8C6Q939_BIK-01       ---------------------------------------tggcccctggg
A0A8C6R2L6_BMF-01       ccacccgcctcccgccgcacccccgattgctcgtcacgctggaccctggt
A0A8C6R2L6_BMF-02       --------------------------------------------------
                                                                          

A0A8C6RUL4_PMAIP1-      --------------------------------------------------
A0A8C6QXX9_BCL2L11      --------------------------------------------------
A0A8C6QXX9_BCL2L11      --------------------------------------------------
A0A8C6QXX9_BCL2L11      --------------------------------------------------
A0A8C6Q9N0_BAD-01       gtgaggaagtctgag-----------------------------------
A0A8C6QGZ2_BBC3-01      ac------------------------------------------------
A0A8C6Q939_BIK-01       gc------------------------------------------------
A0A8C6R2L6_BMF-01       gcagagccctggcatcacgactcggaagctgagactcactcctggagtca
A0A8C6R2L6_BMF-02       --------------------------------------------------
                                                                          

A0A8C6RUL4_PMAIP1-      cccgggagcgaggcgcgtcagagcg-------------------------
A0A8C6QXX9_BCL2L11      gccaag--------------------------------------------
A0A8C6QXX9_BCL2L11      gccaag--------------------------------------------
A0A8C6QXX9_BCL2L11      gccaag--------------------------------------------
A0A8C6Q9N0_BAD-01       tccagcat---------ccggagcc---------tggggagcgacgcggg
A0A8C6QGZ2_BBC3-01      gccaggagggcagttctccggagcc---------cgtagagggcct----
A0A8C6Q939_BIK-01       tccaggaatg-------acagagcc---------tgtgggagaagt----
A0A8C6R2L6_BMF-01       cccaggagaa-------atggagccacctcagtgtgtggaggagct----
A0A8C6R2L6_BMF-02       cccaggagaa-------atggagccacctcagtgtgtggaggagct----
                         **                                               

A0A8C6RUL4_PMAIP1-      --------------------------------cgccatcgaacgccacgc
A0A8C6QXX9_BCL2L11      -------------------------------caaccttccgatg-taagt
A0A8C6QXX9_BCL2L11      -------------------------------caaccttccgatg-taagt
A0A8C6QXX9_BCL2L11      -------------------------------caaccttccgatg-taagt
A0A8C6Q9N0_BAD-01       aggaaggcggtgg-cgaccagcagcccagagcatgttccagatcccagag
A0A8C6QGZ2_BBC3-01      -ggcccgcgatggcccacgtcccttcccgctcggtcgcctgatgccatcg
A0A8C6Q939_BIK-01       -gga----------c--------------ctc---------atg------
A0A8C6R2L6_BMF-01       -ggaagatgatgtgt--------------ttcagccagaagatg------
A0A8C6R2L6_BMF-02       -ggaagatgatgtgt--------------ttcagccagaagatg------
                                                                 *        

A0A8C6RUL4_PMAIP1-      gggcagagctagagttggagtg-------------tgccg----------
A0A8C6QXX9_BCL2L11      tctgagtgtgacagagagggtggacaattgcagcctgctg----------
A0A8C6QXX9_BCL2L11      tctgagtgtgacagagagggtggacaattgcagcctgctg----------
A0A8C6QXX9_BCL2L11      tctgagtgtgacagagagggtggacaattgcagcctgctg----------
A0A8C6Q9N0_BAD-01       tttgag--ccgagtgagcagg-aagactgcagctctgcag--aaaggagc
A0A8C6QGZ2_BBC3-01      gctgtgtcctgcggcctctgtgagccgggcctgcccgccgcccccgccgc
A0A8C6Q939_BIK-01       ---gagtgcctggagggcagt-aaccaggtggccctgcgg----------
A0A8C6R2L6_BMF-01       ---gggagccagggacacagt-ctgggagtttgctctctg----------
A0A8C6R2L6_BMF-02       ---gggagccagggacacagt-ctgggagtttgctctctg----------
                             *             *                 * *          

A0A8C6RUL4_PMAIP1-      -ctcagcttaggagaattggagataaactgaattcc--------------
A0A8C6QXX9_BCL2L11      -agaggcctgcccagctcaggcctggggcacctacctccctccag-----
A0A8C6QXX9_BCL2L11      -agaggcctgcccagctcaggcctggggcacctacctccctccag-----
A0A8C6QXX9_BCL2L11      -agaggcctgcccagctcaggcctggggcacctacctccctccag-----
A0A8C6Q9N0_BAD-01       ctggggcctgtcctggctggggaccagtcaggtctctgccc------ggc
A0A8C6QGZ2_BBC3-01      ccctgccctg-c-tgcccgccgcc----tacctctgcgccccca------
A0A8C6Q939_BIK-01       --ctggcctg-cat---tggagatgagatggatctgcaccttcgg-----
A0A8C6R2L6_BMF-01       --ctgacctg-tttgcccagagcc-agctggat-tgccccctcagccggc
A0A8C6R2L6_BMF-02       --ctgacctg-tttgcccagagcc-agctggat-tgccccctcagccggc
                              * *                       *                 

A0A8C6RUL4_PMAIP1-      -actgggcgtgctgctgac-----------------------------at
A0A8C6QXX9_BCL2L11      -acagaacagcaaggtaatcccgaaggcgaaggggaccgctgcccccacg
A0A8C6QXX9_BCL2L11      -acagaacagca--------------------------------------
A0A8C6QXX9_BCL2L11      -acagaacagca--------------------------------------
A0A8C6Q9N0_BAD-01       cccaggtctcctaggggacaccagtcacc-------------------ag
A0A8C6QGZ2_BBC3-01      ------ccgcccagcctgccgtcaccgccgccctggggggcccccgctgg
A0A8C6Q939_BIK-01       ---agccc--ccatctgacc--ca-----gc-----------------tg
A0A8C6R2L6_BMF-01       ttcagctcttccctcttacc--cactgctgt-----------------gg
A0A8C6R2L6_BMF-02       ttcagctcttccctcttacc--cactgctgt-----------------gg
                               *                                          

A0A8C6RUL4_PMAIP1-      cacagcagtgctagcaga--------------------------------
A0A8C6QXX9_BCL2L11      gcagccctcagggcccgctggccccaccggccagccctgggccttttgct
A0A8C6QXX9_BCL2L11      --------------------------------------------------
A0A8C6QXX9_BCL2L11      --------------------------------------------------
A0A8C6Q9N0_BAD-01       cagaggggtgcgaccaacagcagccatcatggaggcgctg----------
A0A8C6QGZ2_BBC3-01      cctggggctccccgcagc--------------cggccccg----------
A0A8C6Q939_BIK-01       cccgggatt-----------------------------------------
A0A8C6R2L6_BMF-01       ccctgggctccggcccat--------------tagccagg----------
A0A8C6R2L6_BMF-02       ccctgggctccggcccat--------------tagccagg----------
                                                                          

A0A8C6RUL4_PMAIP1-      --------------------------------------------------
A0A8C6QXX9_BCL2L11      accagatccccgcttttcatctttgtgagaagatcttctctgctgtcccg
A0A8C6QXX9_BCL2L11      --------------------------------------------------
A0A8C6QXX9_BCL2L11      --------------------------------------------------
A0A8C6Q9N0_BAD-01       --------------------------------------------------
A0A8C6QGZ2_BBC3-01      --------------------------------------------------
A0A8C6Q939_BIK-01       --------------------------------------------------
A0A8C6R2L6_BMF-01       --------------------------------------------------
A0A8C6R2L6_BMF-02       --------------------------------------------------
                                                                          

A0A8C6RUL4_PMAIP1-      -----------------------------------gatgcccgg------
A0A8C6QXX9_BCL2L11      atcctccagtgggtatttctcttttgacacagacaggagcccggca----
A0A8C6QXX9_BCL2L11      ------------------------------agacaggagcccggca----
A0A8C6QXX9_BCL2L11      ------------------------------agacaggagcccggca----
A0A8C6Q9N0_BAD-01       ------------------------------gggctgagacccggagtcgt
A0A8C6QGZ2_BBC3-01      ------------------------------aggcccgcgcccggatggtc
A0A8C6Q939_BIK-01       --------------------------------------gccatgca----
A0A8C6R2L6_BMF-01       ------------------------------aagacaaggccactcagacc
A0A8C6R2L6_BMF-02       ------------------------------aagacaaggccactcagacc
                                                               **         

A0A8C6RUL4_PMAIP1-      ------------------------------------------------aa
A0A8C6QXX9_BCL2L11      ------------cccatgagttgtgacaaat-----------------ca
A0A8C6QXX9_BCL2L11      ------------cccatgagttgtgacaaat-----------------ca
A0A8C6QXX9_BCL2L11      ------------cccatgagttgtgacaaat-----------------ca
A0A8C6Q9N0_BAD-01       cacagttcgtaccccgcggggacggacgagg------atgaaaggatcga
A0A8C6QGZ2_BBC3-01      ctcagccctcgctctcaccggccgagcagca-----cct---------ag
A0A8C6Q939_BIK-01       -------cagcct----------ggctgtca-----cct---------ac
A0A8C6R2L6_BMF-01       ctcagtccagcctccccaagccagggtgtcatgctgccttgtggggtgac
A0A8C6R2L6_BMF-02       ctcagtccagcctccccaagccagggtgtcatgctgccttgtggggtgac
                                                                          

A0A8C6RUL4_PMAIP1-      agaaggctcggaagagcgc-------------------------------
A0A8C6QXX9_BCL2L11      acacaaaccccaagtcctccttgccaggcct-------------------
A0A8C6QXX9_BCL2L11      acacaaaccccaagtcctccttgccaggcct-------------------
A0A8C6QXX9_BCL2L11      acacaaaccccaagtcctccttgccaggcct-------------------
A0A8C6Q9N0_BAD-01       ggaggaac----tcagcccctt----------------------------
A0A8C6QGZ2_BBC3-01      agtctaccgtgcccagcgccccggaggccctg------------------
A0A8C6Q939_BIK-01       agacaaac----------------aggca---------------------
A0A8C6R2L6_BMF-01       agaggaaccccaacgactcttttacggcaatgctggctaccgacttcctc
A0A8C6R2L6_BMF-02       agaggaaccccaacgactcttttacggcaatgctggctaccgacttcctc
                                                                          

A0A8C6RUL4_PMAIP1-      ---gcagcggagcccg---------agccc----tgcgcggttgccggca
A0A8C6QXX9_BCL2L11      ---tcaaccattatctcagtgcgatggcttctataaggcagtctcaggag
A0A8C6QXX9_BCL2L11      ---tcaaccattatctcagtgcgatggcttctataaggcagtctcaggag
A0A8C6QXX9_BCL2L11      ---tcaaccattatctcagtgcgatgg-----------------------
A0A8C6Q9N0_BAD-01       ---ccggggccgctcgcgctcggctccccc--------caacctct----
A0A8C6QGZ2_BBC3-01      ---gcaggaggtcccacccaggc--agccc--------cgggagtccgag
A0A8C6Q939_BIK-01       ---ttaggggtgtcctcagaagcttgaccc-------acagcctct----
A0A8C6R2L6_BMF-01       tccctaccagtttccctgcaggcttgccccttggggagcaggctcctgaa
A0A8C6R2L6_BMF-02       tccctaccagtttccctgcaggcttgccccttggggagcaggctcctgaa
                                      *                                   

A0A8C6RUL4_PMAIP1-      gatctggaagctgagtgcgctcaa------------------ctgagaag
A0A8C6QXX9_BCL2L11      gaacctgcagatatacgccccgaaatatggattgcacaggagctgcggcg
A0A8C6QXX9_BCL2L11      gaacctgcagatatacgccccgaaatatggattgcacaggagctgcggcg
A0A8C6QXX9_BCL2L11      --------agctaaa-------aaacttgaatc--------tctgcagc-
A0A8C6Q9N0_BAD-01       ----------------gggccgcacagcgctacggccgcgagctccggag
A0A8C6QGZ2_BBC3-01      gggaggaggaggagtgggcccggg----agatcggggcccagctgcggcg
A0A8C6Q939_BIK-01       --------gcagccttggagagag---catatggtcctggagattc----
A0A8C6R2L6_BMF-01       gggcagtggcaacatcgagccgaggtacagatcgccagaaagcttcagtg
A0A8C6R2L6_BMF-02       gggcagtggcaacatcgagccgaggtacagatcgccagaaagcttcagtg
                                                                   *      

A0A8C6RUL4_PMAIP1-      aattggagacaaactgaact------------------------------
A0A8C6QXX9_BCL2L11      gattggagatgaatttaacgcctcttacccaaggagggtatttttgaata
A0A8C6QXX9_BCL2L11      gattggagatgaatttaacgcctcttacccaaggagggtatttttgaata
A0A8C6QXX9_BCL2L11      -----------------------ctt---caag----------ctaaata
A0A8C6Q9N0_BAD-01       gatgagtgacgagttccagggctcct---tcaag-ggccttcctcgccca
A0A8C6QGZ2_BBC3-01      gatggcggacgacctcaacgcgcagt---acgagcggcggagactagaag
A0A8C6Q939_BIK-01       -----ctgactcctgtcatctg-------------ggtgtcacct-----
A0A8C6R2L6_BMF-01       cattgcagaccagttccacc---------------ggctccatatgcagc
A0A8C6R2L6_BMF-02       cattgcagaccagttccacc---------------ggctccatatgcagc
                                                                          

A0A8C6RUL4_PMAIP1-      ------------------------ttcggcagaaacttctgaatttgttc
A0A8C6QXX9_BCL2L11      attaccaagcagatgaagaccacccccaaatggttatcttacaactgtta
A0A8C6QXX9_BCL2L11      attaccaagcagatgaagaccacccccaaatggttatcttacaactgtta
A0A8C6QXX9_BCL2L11      a-------------------------------------------------
A0A8C6Q9N0_BAD-01       aagagcgcgggcacggcgacacagat--gcggcaaa-gctccagctggac
A0A8C6QGZ2_BBC3-01      aacaacatcgacaccgcccctcgccctggagggccatatacaatctcttc
A0A8C6Q939_BIK-01       -----------------gaccaggcctgcaggcagctgctgcccttggtc
A0A8C6R2L6_BMF-01       aataccagcagaaccgagaccgagcatggtggcaggtctt---cctattc
A0A8C6R2L6_BMF-02       aataccagcagaaccgagaccgagcatggtggcaggtctt---cctattc
                                                                          

A0A8C6RUL4_PMAIP1-      tccaaactctttaatttaata-----------------------------
A0A8C6QXX9_BCL2L11      cgtttcatcgtccgcctggtgtggagaaggcattga--------------
A0A8C6QXX9_BCL2L11      cgtttcatcgtccgcctggtgtggagaaggcattga--------------
A0A8C6QXX9_BCL2L11      --------------------------------------------------
A0A8C6Q9N0_BAD-01       gcgaatcttccagtcctggtgggatcgaaacttggggaaaggaggctccg
A0A8C6QGZ2_BBC3-01      atgggactcctgcccttaccc----agggaccccagagccccagagatgg
A0A8C6Q939_BIK-01       ttgctggtcctgctgctgggc-------------ggggccctgcacctgc
A0A8C6R2L6_BMF-01       ctgcacaacctggccttgaacagagaaggaaacagggatggggcaggt--
A0A8C6R2L6_BMF-02       ctgcacaacctggccttgaacagagaaggaaacagggatggggcaggt--
                                                                          

A0A8C6RUL4_PMAIP1-      -----acctga
A0A8C6QXX9_BCL2L11      -----------
A0A8C6QXX9_BCL2L11      -----------
A0A8C6QXX9_BCL2L11      -----------
A0A8C6Q9N0_BAD-01       ccccctcttaa
A0A8C6QGZ2_BBC3-01      agcccaactag
A0A8C6Q939_BIK-01       tgcctcagtga
A0A8C6R2L6_BMF-01       --cccaggtga
A0A8C6R2L6_BMF-02       --cccaggtga
                                   

© 1998-2022Legal notice