Dataset for CDS classical BH3-containing proteins of organism Myripristis murdjan

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A667YNR9_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Myripristis murdjan GN=BMF (length=492 residues).
atggacgatgaggaggatgatgtgtttgagccagacctccactgctggcgcaccacattcagggagataaagtgcgaaga
caggggcacacagacacccggccctgccctcacattggccaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggcaacgcgggttttcgattgcacttcccagcacactttgagcttgtcggggaccaggaggcgcggcag
caagaaagggaagaggagcagaacgggatggagcagcgaccccggcagcaacctgttgcgcgcagcgtagaggcccgcat
cggccagaaactccagctgataggagaccagttccatcgggaacatctacaactgtatcatcgaaaccaaaggaaccagg
ggccgttgtggtggcgcctggcctcggctctgctcaaccttctttttgacagaggggctttcgccggaggaggtggagca
ggacggaggtga
>gnl|bcl2dbcds|A0A667ZMY7_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Myripristis murdjan GN=BCL2L11 (length=411 residues).
ttatcagatgtgaccgcggcgcaaaccccccgcgcagcgccggcgaacgaaagcggcggacggtgccgcggccacgccgc
tcctcccggagggaagggggactcgccgtcccggggagccggcccgcccatctcaccgactaacagcctgtccggatatc
agttgaggtcgccgctgttccggcacctgtctcgctcctctagcggatatttctcgtacgacggcgactcgttgcccggc
tccccgaggccagcaacggtggacaaggccacacagactccgagcccctccggccaggcggtgacacacgccgtgctgcg
cctgaccgaggagcacccgcacggtgagcacaggaactcacacacagccagccacgtagacgggccactgccactccgca
tgattcagtag
>gnl|bcl2dbcds|A0A667ZNC6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Myripristis murdjan GN=BAD (length=492 residues).
atggcaagcttcaccatttcagacggcgaatcagatccctcagaggaggtaggggagtcagaaaccgacaaatcactcaa
tcatcaggagcagaaccatcatcttggccacgccctcaccacacctgagctgagaatgtcagcaagtggccgggtcaggc
tgaactctgaatcccacgtctccactgtctccaaagacgaggagctcctggccaggggggaaggagaggatggtgacgga
gctcctttccggggtcgctcccagtcggcgccccctgccctctgggcggccaagaaatatggccgtcagctccgaagaat
gagtgacgagtttgacagcttgctggacaaaggggagatgaagagggttaggagtgctgggacggccaaacagatgcagc
actccaaaagctggtggaactacctcttcagtcaccaggagacagaaggagagaccagccaccatgaaaaccacagtaac
cgcactgagtag
© 1998-2020Legal notice