Dataset for CDS classical BH3-containing proteins of organism Myripristis murdjan

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A667ZMY7_BCL2L11      ttatcagatgtgaccgcggcg--------------caaaccccccgcgca
A0A667YNR9_BMF-01       ---------atggacgatgaggaggatgatgtgtttgagccagacctcca
A0A667ZNC6_BAD-01       ---------atgg----------------------caagcttcaccattt
                                  **                         * *    *     

A0A667ZMY7_BCL2L11      gcgccggcgaacgaaagcggcggacggtgccgcggccacgccgctcctcc
A0A667YNR9_BMF-01       ctgctggcgcaccaca----------------------------ttc---
A0A667ZNC6_BAD-01       cagacggcgaatcaga----------------------------tccctc
                          *  **** *  * *                            * *   

A0A667ZMY7_BCL2L11      cggagggaag----ggggactcgccgtcccggggagc---cggcccg---
A0A667YNR9_BMF-01       -agggagataaagtgcgaagacaggggcacacaga-cacccggccct---
A0A667ZNC6_BAD-01       agaggaggta----ggggagtcagaaaccgacaaatcactcaatcatcag
                            * *       * * *  *     *      * *   *   *     

A0A667ZMY7_BCL2L11      -------cccatctcaccgacta-------acagc---ctgtccgg----
A0A667YNR9_BMF-01       -------gccctcacattggcca-------acggcatgctgccctgtgga
A0A667ZNC6_BAD-01       gagcagaaccatcatcttggccacgccctcaccacac-ctgagctg-aga
                                ** **     * * *       **  *   ***  * *    

A0A667ZMY7_BCL2L11      atatcagttgaggtcgccgctgttcc-------------ggcacctgtct
A0A667YNR9_BMF-01       gtcgcag-aggagcccagaccactcttctacggcaacgcgggttttcgat
A0A667ZNC6_BAD-01       atgtcagcaagtggccgggtcaggct-------------gaactctgaat
                         *  ***     * *         *              *     *   *

A0A667ZMY7_BCL2L11      cgctcctctagcggatatttctcgtacgacggcgactcgttgcccggctc
A0A667YNR9_BMF-01       tgcacttccca-gcacactttgagcttgtcggggaccag------gaggc
A0A667ZNC6_BAD-01       cccacgtctc-----cactg-----tctccaaagacgag------gagct
                          * * **        * *          *   ***  *      *    

A0A667ZMY7_BCL2L11      cccgaggccagcaacggtggacaaggccacacagactccgagcccctccg
A0A667YNR9_BMF-01       gcggcagcaagaaagggaagaggagcagaacgggatg--gagc-------
A0A667ZNC6_BAD-01       cctg--gccag---gggggaaggagaggatggtgacg--gagctcctttc
                         * *  ** **    **   *  **   *    **    ****       

A0A667ZMY7_BCL2L11      gccaggcggt-------gacacacgccgtgctgcgcctgaccgaggagca
A0A667YNR9_BMF-01       ----agcgaccccggcagcaacctgttgc-----gcgcagcgtagaggcc
A0A667ZNC6_BAD-01       cggggtcgctcccagtcggcgccccctgccctctgggcggccaagaaata
                              **         *   *     *      *     *  **     

A0A667ZMY7_BCL2L11      ----------------cccgcacggtgagc--------------------
A0A667YNR9_BMF-01       cgcatcggccagaaactccagctgataggagaccagttccatcgggaaca
A0A667ZNC6_BAD-01       -----tggccgtcagctccgaagaatgagtgacgagttt-------gaca
                                         **      *  *                     

A0A667ZMY7_BCL2L11      ---------acag----------gaactca--------------cacaca
A0A667YNR9_BMF-01       tct------acaactgtatcatcgaaaccaaaggaaccaggggccgttgt
A0A667ZNC6_BAD-01       gcttgctggacaaaggg------gagatgaagagggttaggag-tgctgg
                                 ***           **    *                    

A0A667ZMY7_BCL2L11      gccagccacgtagacgggcc------------------actgccactcc-
A0A667YNR9_BMF-01       ggtgg-cgcctggcctcggc---------tctgctcaaccttcttttt--
A0A667ZNC6_BAD-01       gacggccaaacagatgcagcactccaaaagctggtggaactacctcttca
                        *   * *     *      *                   ** *   *   

A0A667ZMY7_BCL2L11      ------------------------------------------------gc
A0A667YNR9_BMF-01       ----------gacagaggg--------gctttcgccggaggaggtggagc
A0A667ZNC6_BAD-01       gtcaccaggagacagaaggagagaccagccaccatgaaaaccacagtaac

A0A667ZMY7_BCL2L11      atgattcagtag-
A0A667YNR9_BMF-01       aggacggaggtga
A0A667ZNC6_BAD-01       cgcactgagtag-
                           *   **  * 

© 1998-2021Legal notice