Dataset for CDS classical BH3-containing proteins of organism Mus spicilegus

[Download (right click)] [Alignment] [Repertoires]

11 sequence(s)

>gnl|bcl2dbcds|A0A8C6GZK8_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Mus spicilegus GN=BMF (length=816 residues).
atgcccggagcgggcgtattttggaaacaataccgcgcggtgtgccttggcctcctcccgcgccagctcgcgcctgcagc
cttcgctgccgcagcccgcgccaccgcctcccaccgcagcccgctggagtttgcccccttcttcccaatcgagtgtgggc
accaagccccccgagtgttcttcaccctggaccctggcgcagagccctggcatcacaactcggaggctgagacgctgtcc
tggagtcacccaggagagatggagccacctcagtgtgtggaggagctagaagatgatgtgttccagtcagaggatgggga
gccagggacacagcctgggggcttgctctctgctgacctgtttgcccagagccagctggactgtcccctcagtcggctcc
agctcttccctctcacccactgctgtggtcccggactccggcccataagccaggaagacaaggccactcagaccctcagt
ccagcttccccaagccagggtgtcatgctgccttgtggggtgacagaggaaccccagagactcttttacggcaacgctgg
ctacaggcttcctctccctgccagtttccctgcaggctcaccccttggggagcagccccctgaaggacagttccttcagc
accgagcagaggtgcagatcgccagaaagcttcagtgtattgcagaccagttccatcggcttcatacgcaacaacaccag
cagaaccgagaccgtgcgtggtggcaggtcttcctcttccttcaaaacctcgccctgaacagacaagaaaacagggaagg
ggtggggccctggtga
>gnl|bcl2dbcds|A0A8C6GZK8_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Mus spicilegus GN=BMF (length=558 residues).
atggagccacctcagtgtgtggaggagctagaagatgatgtgttccagtcagaggatggggagccagggacacagcctgg
gggcttgctctctgctgacctgtttgcccagagccagctggactgtcccctcagtcggctccagctcttccctctcaccc
actgctgtggtcccggactccggcccataagccaggaagacaaggccactcagaccctcagtccagcttccccaagccag
ggtgtcatgctgccttgtggggtgacagaggaaccccagagactcttttacggcaacgctggctacaggcttcctctccc
tgccagtttccctgcaggctcaccccttggggagcagccccctgaaggacagttccttcagcaccgagcagaggtgcaga
tcgccagaaagcttcagtgtattgcagaccagttccatcggcttcatacgcaacaacaccagcagaaccgagaccgtgcg
tggtggcaggtcttcctcttccttcaaaacctcgccctgaacagacaagaaaacagggaaggggtggggccctggtga
>gnl|bcl2dbcds|A0A8C6GZK8_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Mus spicilegus GN=BMF (length=558 residues).
atggagccacctcagtgtgtggaggagctagaagatgatgtgttccagtcagaggatggggagccagggacacagcctgg
gggcttgctctctgctgacctgtttgcccagagccagctggactgtcccctcagtcggctccagctcttccctctcaccc
actgctgtggtcccggactccggcccataagccaggaagacaaggccactcagaccctcagtccagcttccccaagccag
ggtgtcatgctgccttgtggggtgacagaggaaccccagagactcttttacggcaacgctggctacaggcttcctctccc
tgccagtttccctgcaggctcaccccttggggagcagccccctgaaggacagttccttcagcaccgagcagaggtgcaga
tcgccagaaagcttcagtgtattgcagaccagttccatcggcttcatacgcaacaacaccagcagaaccgagaccgtgcg
tggtggcaggtcttcctcttccttcaaaacctcgccctgaacagacaagaaaacagggaaggggtggggccctggtga
>gnl|bcl2dbcds|A0A8C6HE78_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Mus spicilegus GN=BIK (length=477 residues).
atgtcggaggcgagacttatggccagagacgtcatcaagactgttccacacgaccaggtcccccaacctccagtggcctc
tgagactcccagcatgaaggagcctgtggctggggaaaaccttagtcctgtgagagacgtggacctcatggagtgcgtgg
aaggcagaaaccaggtggccttgaggctggcctgcattggcgatgagatggacctgtgtctgcggagcccccgtctggtc
cagctgcctgggattgctatacacagactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagcttgat
tcgaagtctcaccaacctcagggaaaacatctggtcctggatagtcttgtctcctggcgcctgggtgtcacctgaccagg
accctgggcagctgtttccaatggtgctgctggtcttcttgctgctgggtggggcctggtatttgcagcttcagtga
>gnl|bcl2dbcds|A0A8C6HE78_BIK-02 BCL2-interacting killer gene OS=[Eukaryota] Mus spicilegus GN=BIK (length=321 residues).
aagttcactagaaaccaggtggccttgaggctggcctgcattggcgatgagatggacctgtgtctgcggagcccccgtct
ggtccagctgcctgggattgctatacacagactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagct
tgattcgaagtctcaccaacctcagggaaaacatctggtcctggatagtcttgtctcctggcgcctgggtgtcacctgac
caggaccctgggcagctgtttccaatggtgctgctggtcttcttgctgctgggtggggcctggtatttgcagcttcagtg
a
>gnl|bcl2dbcds|A0A8C6HGQ3_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Mus spicilegus GN=BCL2L11 (length=813 residues).
atgatcccggcggcggccggtgcagcgcgggccagaggcgcggcgcgcgaaaccttcggctccccggcggagcgtggcgg
agggcggacgggcaggcgcggggccctggagcccaggacccggctttgtttcccttgcctcctcggtggcgacgtgcagg
ggtcgttcgatcggcgcaacacgccgcgctcggaagggaaggggcggacaaaaaaagaccaaatggccaagcaaccttct
gatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctccccagctcaggcctggggcccc
tacctccctacagacagaaccgcaaggtaatcccgacggcgaaggggaccgctgcccccacggcagccctcagggcccgc
tggccccaccggccagccctggcccttttgctaccagatccccacttttcatctttgtgagaagatcttctctgctgtcc
cggtcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtgacaagtcaacacaaacccc
aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccataagacagtctcaggaggaacctgaagatc
tgcgcccggagatacggattgcacaggagctgcggcggatcggagacgagttcaacgaaacttacacaaggagggtaagg
acctctccccatccccagagaaagtgcgactgcggagatatggcccccttctgcaccttacgttatctctctcctaattc
tgctctgacctga
>gnl|bcl2dbcds|A0A8C6HGQ3_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Mus spicilegus GN=BCL2L11 (length=675 residues).
atgattttaaaacttaatttgctgaagataatcgttttgttgtgccccccccccaccctgtttccttgcagaaaaaaaga
ccaaatggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctc
cccagctcaggcctggggcccctacctccctacagacagaaccgcaaggtaatcccgacggcgaaggggaccgctgcccc
cacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccacttttcatctttgt
gagaagatcttctctgctgtcccggtcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagtt
gtgacaagtcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccataagacag
tctcaggaggaacctgaagatctgcgcccggagatacggattgcacaggagctgcggcggatcggagacgagttcaacga
aacttacacaaggagggtgtttgcaaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaactgttac
gctttatcttccgtctggtatggagaaggcattga
>gnl|bcl2dbcds|A0A8C6HGQ3_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Mus spicilegus GN=BCL2L11 (length=645 residues).
atgatcccggcggcggccggtgcagcgcgggccagaggcgcggcgcgcgaaaccttcggctccccggcggagcgtggcgg
agggcggacgggcaggcgcggggccctggagcccaggacccggctttgtttcccttgcctcctcggtggcgacgtgcagg
ggtcgttcgatcggcgcaacacgccgcgctcggaagggaaggggcggacaaaaaaagaccaaatggccaagcaaccttct
gatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctccccagctcaggcctggggcccc
tacctccctacagacagaaccgcaagacaggagcccggcacccatgagttgtgacaagtcaacacaaaccccaagtcctc
cttgccaggccttcaaccactatctcagtgcaatggcttccataagacagtctcaggaggaacctgaagatctgcgcccg
gagatacggattgcacaggagctgcggcggatcggagacgagttcaacgaaacttacacaaggagggtaaggacctctcc
ccatccccagagaaagtgcgactgcggagatatggcccccttctgcaccttacgttatctctctcctaattctgctctga
cctga
>gnl|bcl2dbcds|A0A8C6HHE2_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Mus spicilegus GN=BBC3 (length=1032 residues).
atggggttcgggctcgcccgcgccccctggtggttagtgagatctgggaggagcgtggccccgggctcgctcgagtcccc
cgagtcccactgcgggagggttggggtgggggggtggcaccgaggatcggccacacccagagcgcgcgcccgccgggggc
ggcgacagggggcggcggaggctgtggctcccgcgggcgggggctgcgccccagcaacagccggttattggccccgcgcg
cgctgggcgggcggggcggcaggcaggtggggagggggctgcacaccccggcagctgtgggggggcggcggggaccgcgc
gtgcggggctgtggatctgcaggtgtctcgcctgggtgtgtgtgctcgtgtctggctcccgagtttgtatccctacaccg
agatgttggcgtttgtcacccggaggggtgtctgcgctccagggagcgccatggcccgcgcacgccaggagggcagctct
ccggagcccgtagagggtctagcccgcgacagtccgcgccccttcccgcttggccgcctgatgccctccgctgtatcctg
cagcctttgcgagcccggcctgcccgccgcccctgctgcccctgccttgctgccggccgcctacctctgcgcccccaccg
ctccacctgccgtcaccgccgccctggggggcccccgctggcctgggggtcaccgcagccggcccagaggcccgcgcccg
gacggacctcagccctccctgtcaccagcccagcagcacttagagtcgcccgtgcccagcgccccggaggccctggcagg
aggccccacccaagctgccccgggagtgcgtgtggaggaggaggagtgggcccgggagatcggggcccagctgcggcgga
tggcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcagcatcgacaccgaccctcaccctggagggtc
atgtacaatctcttcatgggactcctccccttacccagggatcctggagccccagaaatggagcccaactag
>gnl|bcl2dbcds|A0A8C6HML5_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Mus spicilegus GN=PMAIP1 (length=312 residues).
atgcccaggagaaaggcgcgtcggaacgcgccagtgaacccaacgcgggcagagctaccacctgagttcgcagctcaact
caggaagatcggagacaaagtgtattgcacgtggagtgcaccggacataactgtggttctggcgcagatgcctgggaagt
cgcaaaagggcaggatgaggagcccaagcccaaccagggtgccagcagacttgaaggacgagtgtgctcaactccggaga
attggagacaaagtgaatttacggcagaaacttctgaatttgatttccaagctcttcaatttagtaacctga
>gnl|bcl2dbcds|A0A8C6IHC9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mus spicilegus GN=BAD (length=615 residues).
atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtccgatcccggaatccggagcct
ggggagcgacgcgggaggaaggcggtggagaccagcagcccagagtatgttccagatcccagagtttgagccgagtgagc
aggaagacgctagtgctacagataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
ctcctgggcagcatcgttcatcagcagggacgggcagccaccaacagtcatcatggaggcgcaggggctatggagactcg
gagtcgccacagttcgtacccagcggggaccgaggaggatgaagggatggaggaggagcttagcccttttcgaggacgct
cgcgttcggctccccccaatctctgggcagcgcagcgctacggccgtgagctccgaagaatgagcgatgagtttgagggt
tccttcaagggacttcctcgcccaaagagcgcaggcactgcaacacagatgcgacaaagctccagctggacgcgcattat
ccagtcctggtgggatcgaaacttgggcaaaggagactccaccccctcccagtga
© 1998-2022Legal notice