Dataset for CDS classical BH3-containing proteins of organism Mus spicilegus

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6HGQ3_BCL2L11      atgatttt------------------------------------------
A0A8C6HGQ3_BCL2L11      atgatcccggcggcggccggtgc----------------agcgcgggcca
A0A8C6HGQ3_BCL2L11      atgatcccggcggcggccggtgc----------------agcgcgggcca
A0A8C6IHC9_BAD-01       atgggaacc-----------------------------------------
A0A8C6HML5_PMAIP1-      atgcc---------------------------------------------
A0A8C6HE78_BIK-01       atgtcggaggcgagacttatggccagagacgtcatcaagactgttccaca
A0A8C6HE78_BIK-02       --------------------------------------------------
A0A8C6HHE2_BBC3-01      atggggttcgggctcgcccgcgccccctggtggttagtgagatctgggag
A0A8C6GZK8_BMF-01       ----------------------------------atgcccggagcgggcg
A0A8C6GZK8_BMF-02       --------------------------------------------------
A0A8C6GZK8_BMF-03       --------------------------------------------------
                                                                          

A0A8C6HGQ3_BCL2L11      ---------------aaaacttaattt---------------gctgaaga
A0A8C6HGQ3_BCL2L11      gaggcgcggcgcgcgaaaccttcggctccccggcggagcgtggcggaggg
A0A8C6HGQ3_BCL2L11      gaggcgcggcgcgcgaaaccttcggctccccggcggagcgtggcggaggg
A0A8C6IHC9_BAD-01       --------ccaaagcagccctcgctggctcctgcacacgccctaggcttg
A0A8C6HML5_PMAIP1-      --------------------------------------------------
A0A8C6HE78_BIK-01       cgaccaggtcccccaacctccagtggcctctgagactcccagcatgaagg
A0A8C6HE78_BIK-02       -----aagttcac-------------------------------------
A0A8C6HHE2_BBC3-01      gagcgtggccccgggctcgctcgagtcccccgagtcccactgcgggaggg
A0A8C6GZK8_BMF-01       tattttggaaacaataccgcgcggtgtgccttggcctcctcccgcgccag
A0A8C6GZK8_BMF-02       --------------------------------------------------
A0A8C6GZK8_BMF-03       --------------------------------------------------
                                                                          

A0A8C6HGQ3_BCL2L11      taatcgttttgttgtgcccccc------------ccccaccctgtttcct
A0A8C6HGQ3_BCL2L11      cggacgggcaggcgcggggccctggagcccaggacccggctttgtttccc
A0A8C6HGQ3_BCL2L11      cggacgggcaggcgcggggccctggagcccaggacccggctttgtttccc
A0A8C6IHC9_BAD-01       aggaagtccgatcccggaatccggagcctg--------------------
A0A8C6HML5_PMAIP1-      --------------------------------------------------
A0A8C6HE78_BIK-01       agcctgtggctggggaaaaccttagtcctgtgagagacgtggacct----
A0A8C6HE78_BIK-02       --------------------------------------------------
A0A8C6HHE2_BBC3-01      ttggggtgggggggtggcaccgaggatcggccacacccagagcgcgcgcc
A0A8C6GZK8_BMF-01       ctcgcgcctgcagccttcgctg--------ccgcagcccgcgccaccgcc
A0A8C6GZK8_BMF-02       --------------------------------------------------
A0A8C6GZK8_BMF-03       --------------------------------------------------
                                                                          

A0A8C6HGQ3_BCL2L11      --------------------tgcag-------------------------
A0A8C6HGQ3_BCL2L11      ttgcctcctcggtggcgacgtgcaggggtcgttcgatcg-----------
A0A8C6HGQ3_BCL2L11      ttgcctcctcggtggcgacgtgcaggggtcgttcgatcg-----------
A0A8C6IHC9_BAD-01       --------------------------------------------------
A0A8C6HML5_PMAIP1-      --------------------------------------------------
A0A8C6HE78_BIK-01       --------------------------------------------------
A0A8C6HE78_BIK-02       --------------------------------------------------
A0A8C6HHE2_BBC3-01      cgccgggggcggcgacagggggcggcggaggctgtggctcccgcgggcgg
A0A8C6GZK8_BMF-01       tcccaccgcagcccgctggagtttgcccccttcttcccaatcgagtgtgg
A0A8C6GZK8_BMF-02       --------------------------------------------------
A0A8C6GZK8_BMF-03       --------------------------------------------------
                                                                          

A0A8C6HGQ3_BCL2L11      --------------------------------------------------
A0A8C6HGQ3_BCL2L11      --------------------------gcgcaacacgccgcgctcggaagg
A0A8C6HGQ3_BCL2L11      --------------------------gcgcaacacgccgcgctcggaagg
A0A8C6IHC9_BAD-01       --------------------------------------------------
A0A8C6HML5_PMAIP1-      --------------------------------------------------
A0A8C6HE78_BIK-01       ---------------------------------------catggagtgcg
A0A8C6HE78_BIK-02       --------------------------------------------------
A0A8C6HHE2_BBC3-01      gggctgcgccccagcaacagccggt-tattggccccgcgcgcgctgggcg
A0A8C6GZK8_BMF-01       gcaccaagccccccgagtgttcttcaccctggaccctggcgcagagccct
A0A8C6GZK8_BMF-02       --------------------------------------------------
A0A8C6GZK8_BMF-03       --------------------------------------------------
                                                                          

A0A8C6HGQ3_BCL2L11      ------------aaaaaaagaccaaatggccaagcaaccttctgatgtaa
A0A8C6HGQ3_BCL2L11      gaaggggcggacaaaaaaagaccaaatggccaagcaaccttctgatgtaa
A0A8C6HGQ3_BCL2L11      gaaggggcggacaaaaaaagaccaaatggccaagcaaccttctgatgtaa
A0A8C6IHC9_BAD-01       --------gggagcgacgcgggaggaaggcggtggagaccagcagc----
A0A8C6HML5_PMAIP1-      -------caggagaaaggcgcgtcggaacgcgccagtgaacccaacgcgg
A0A8C6HE78_BIK-01       tggaaggcagaaaccaggtggccttgaggctg-----gcctgcattggcg
A0A8C6HE78_BIK-02       -------tagaaaccaggtggccttgaggctg-----gcctgcattggcg
A0A8C6HHE2_BBC3-01      ggcggggcggcaggcaggtggggagggggctgcacaccccggcagctgtg
A0A8C6GZK8_BMF-01       ggcatcacaactcggaggctgagacgctgtcctggagtcacccaggagag
A0A8C6GZK8_BMF-02       --------------------------------------------------
A0A8C6GZK8_BMF-03       --------------------------------------------------
                                                                          

A0A8C6HGQ3_BCL2L11      gt------------------------------------------------
A0A8C6HGQ3_BCL2L11      gt------------------------------------------------
A0A8C6HGQ3_BCL2L11      gt------------------------------------------------
A0A8C6IHC9_BAD-01       --------------------------------------------------
A0A8C6HML5_PMAIP1-      gcagagc---------------------------------------tacc
A0A8C6HE78_BIK-01       atgagatgg-----------------------------------------
A0A8C6HE78_BIK-02       atgagatgg-----------------------------------------
A0A8C6HHE2_BBC3-01      ggggggcggcggggaccgcgcgtgcggggctgtggatctgcaggtgtctc
A0A8C6GZK8_BMF-01       atggagc------------------------------------------c
A0A8C6GZK8_BMF-02       atggagc------------------------------------------c
A0A8C6GZK8_BMF-03       atggagc------------------------------------------c
                                                                          

A0A8C6HGQ3_BCL2L11      -tctgagtgtgac--------------------------------agaga
A0A8C6HGQ3_BCL2L11      -tctgagtgtgac--------------------------------agaga
A0A8C6HGQ3_BCL2L11      -tctgagtgtgac--------------------------------agaga
A0A8C6IHC9_BAD-01       -ccagagtatgtt--------ccagatcccagagtttgagccgagtgagc
A0A8C6HML5_PMAIP1-      acctgagttcgca-------------------------------------
A0A8C6HE78_BIK-01       acctgtgtctgcg------------------gagcccccgtc--------
A0A8C6HE78_BIK-02       acctgtgtctgcg------------------gagcccccgtc--------
A0A8C6HHE2_BBC3-01      gcctgggtgtgtgtgctcgtgtctggctcccgagtttgtatccctacacc
A0A8C6GZK8_BMF-01       acctcagtgtgtg------------------gagg------------agc
A0A8C6GZK8_BMF-02       acctcagtgtgtg------------------gagg------------agc
A0A8C6GZK8_BMF-03       acctcagtgtgtg------------------gagg------------agc
                          *   **  *                                       

A0A8C6HGQ3_BCL2L11      aggtggacaattgcagcctgctgagaggcctcccca--------------
A0A8C6HGQ3_BCL2L11      aggtggacaattgcagcctgctgagaggcctcccca--------------
A0A8C6HGQ3_BCL2L11      aggtggacaattgcagcctgctgagaggcctcccca--------------
A0A8C6IHC9_BAD-01       aggaagacgctagtgctacagataggg-----------------------
A0A8C6HML5_PMAIP1-      --------------------------------------------------
A0A8C6HE78_BIK-01       -------------tggtccagct---------------------------
A0A8C6HE78_BIK-02       -------------tggtccagct---------------------------
A0A8C6HHE2_BBC3-01      gagatgttggc-gtttgtcacccggaggggtgtctgcgctccagggagcg
A0A8C6GZK8_BMF-01       tagaagatgat-gtgttccagtcagagg--------------atggggag
A0A8C6GZK8_BMF-02       tagaagatgat-gtgttccagtcagagg--------------atggggag
A0A8C6GZK8_BMF-03       tagaagatgat-gtgttccagtcagagg--------------atggggag
                                                                          

A0A8C6HGQ3_BCL2L11      ---------gctcaggcctggggcccctacctccctacagaca-------
A0A8C6HGQ3_BCL2L11      ---------gctcaggcctggggcccctacctccctacagaca-------
A0A8C6HGQ3_BCL2L11      ---------gctcaggcctggggcccctacctccctacagaca-------
A0A8C6IHC9_BAD-01       ---------------gcctgggc--cctagcctcactgaggac-------
A0A8C6HML5_PMAIP1-      ---------gctcaactcaggaa--gat-------cggagaca---aagt
A0A8C6HE78_BIK-01       ---------------gcctg--g--gattgctatacacagact-------
A0A8C6HE78_BIK-02       ---------------gcctg--g--gattgctatacacagact-------
A0A8C6HHE2_BBC3-01      ccatggcccgcgcacgccaggag--ggcagctctccggagcccgtagagg
A0A8C6GZK8_BMF-01       ccaggg---acaca-gcctgggg--gcttgctctctgctgacc------t
A0A8C6GZK8_BMF-02       ccaggg---acaca-gcctgggg--gcttgctctctgctgacc------t
A0A8C6GZK8_BMF-03       ccaggg---acaca-gcctgggg--gcttgctctctgctgacc------t
                                         * *                   *          

A0A8C6HGQ3_BCL2L11      gaaccgcaaggtaatcccgacggcgaaggggaccgctgcccccacggcag
A0A8C6HGQ3_BCL2L11      gaaccgcaaggtaatcccgacggcgaaggggaccgctgcccccacggcag
A0A8C6HGQ3_BCL2L11      gaaccgca------------------------------------------
A0A8C6IHC9_BAD-01       ---cagccaggtccctacctggccccaggtctcctgggcagcatcgttca
A0A8C6HML5_PMAIP1-      gtattgcacgtg-----------------------gagtgca--------
A0A8C6HE78_BIK-01       -----------------------------------cgctgtc----acct
A0A8C6HE78_BIK-02       -----------------------------------cgctgtc----acct
A0A8C6HHE2_BBC3-01      gtctagcccgcgacagtccgcgccccttcccgcttggccgcctgatgccc
A0A8C6GZK8_BMF-01       gtttgcccagag----------------ccagctggactgtc-----ccc
A0A8C6GZK8_BMF-02       gtttgcccagag----------------ccagctggactgtc-----ccc
A0A8C6GZK8_BMF-03       gtttgcccagag----------------ccagctggactgtc-----ccc
                                                                          

A0A8C6HGQ3_BCL2L11      ccctcagggcccgctggccccaccggccagccctggcccttttgctacca
A0A8C6HGQ3_BCL2L11      ccctcagggcccgctggccccaccggccagccctggcccttttgctacca
A0A8C6HGQ3_BCL2L11      --------------------------------------------------
A0A8C6IHC9_BAD-01       tcagcagggacgggcagc--------------------------------
A0A8C6HML5_PMAIP1-      ----ccggaca---------------------------------------
A0A8C6HE78_BIK-01       acagccggaca---------------------------------------
A0A8C6HE78_BIK-02       acagccggaca---------------------------------------
A0A8C6HHE2_BBC3-01      tccgctgtatcctgcagcctttgcgagcccggcctgcccgccgcccctgc
A0A8C6GZK8_BMF-01       tcagtcggctcc-------------agctcttccctctcac---------
A0A8C6GZK8_BMF-02       tcagtcggctcc-------------agctcttccctctcac---------
A0A8C6GZK8_BMF-03       tcagtcggctcc-------------agctcttccctctcac---------
                                                                          

A0A8C6HGQ3_BCL2L11      gatccccacttttcatctttgtgagaagatcttctctgctgtcccgg---
A0A8C6HGQ3_BCL2L11      gatccccacttttcatctttgtgagaagatcttctctgctgtcccgg---
A0A8C6HGQ3_BCL2L11      --------------------------------------------------
A0A8C6IHC9_BAD-01       --caccaacagtcatcat------ggagg----cgcaggggctatggaga
A0A8C6HML5_PMAIP1-      -----taactgtggttct------gg-------cgcagatgcc-------
A0A8C6HE78_BIK-01       ------------ggtgtc------agaggtattttcaggagct-------
A0A8C6HE78_BIK-02       ------------ggtgtc------agaggtattttcaggagct-------
A0A8C6HHE2_BBC3-01      tgcccctgccttgctgcc------ggccgcctacctctgcgccccca---
A0A8C6GZK8_BMF-01       --ccactgctgtggtccc------ggactccggcccataagccaggaaga
A0A8C6GZK8_BMF-02       --ccactgctgtggtccc------ggactccggcccataagccaggaaga
A0A8C6GZK8_BMF-03       --ccactgctgtggtccc------ggactccggcccataagccaggaaga
                                                                          

A0A8C6HGQ3_BCL2L11      ------tcctccagtgggtatttctcttttgacacagacaggagcccggc
A0A8C6HGQ3_BCL2L11      ------tcctccagtgggtatttctcttttgacacagacaggagcccggc
A0A8C6HGQ3_BCL2L11      -----------------------------------agacaggagcccggc
A0A8C6IHC9_BAD-01       ctcggagtcgccacagttcgtacccagc-----------ggggaccgagg
A0A8C6HML5_PMAIP1-      -------------------------------------tgggaagtc----
A0A8C6HE78_BIK-01       -----tgattc-----------------------------gaagtctcac
A0A8C6HE78_BIK-02       -----tgattc-----------------------------gaagtctcac
A0A8C6HHE2_BBC3-01      -----ccgctccacctgccgtcaccgccgccctg----gggggcccccgc
A0A8C6GZK8_BMF-01       caaggccactcagaccctcagtccagcttccccaagccagggtgtcatgc
A0A8C6GZK8_BMF-02       caaggccactcagaccctcagtccagcttccccaagccagggtgtcatgc
A0A8C6GZK8_BMF-03       caaggccactcagaccctcagtccagcttccccaagccagggtgtcatgc
                                                                *    *    

A0A8C6HGQ3_BCL2L11      acccatgagttgtgacaagtcaacacaaaccccaagtcc--tccttgcca
A0A8C6HGQ3_BCL2L11      acccatgagttgtgacaagtcaacacaaaccccaagtcc--tccttgcca
A0A8C6HGQ3_BCL2L11      acccatgagttgtgacaagtcaacacaaaccccaagtcc--tccttgcca
A0A8C6IHC9_BAD-01       aggatgaagggatggaggaggagctt--------agcccttttcgag---
A0A8C6HML5_PMAIP1-      -----------gcaaaagggcaggatgag----gagcccaagcccaacca
A0A8C6HE78_BIK-01       caacctcaggga---------------aa----acatctggtcctgg---
A0A8C6HE78_BIK-02       caacctcaggga---------------aa----acatctggtcctgg---
A0A8C6HHE2_BBC3-01      tggcctgggggtcaccgcagccggcccag----aggcccgcgcccgg---
A0A8C6GZK8_BMF-01       tgccttgtggggtgacagaggaaccccag----agactcttttacggcaa
A0A8C6GZK8_BMF-02       tgccttgtggggtgacagaggaaccccag----agactcttttacggcaa
A0A8C6GZK8_BMF-03       tgccttgtggggtgacagaggaaccccag----agactcttttacggcaa
                                                                          

A0A8C6HGQ3_BCL2L11      ggccttcaaccactatctcagtgcaatggcttccataagacagtctcagg
A0A8C6HGQ3_BCL2L11      ggccttcaaccactatctcagtgcaatggcttccataagacagtctcagg
A0A8C6HGQ3_BCL2L11      ggccttcaaccactatctcagtgcaatggcttccataagacagtctcagg
A0A8C6IHC9_BAD-01       ----gacgctcgcgttcggctccccccaatctctgggcagcgc-----ag
A0A8C6HML5_PMAIP1-      gggtgccagcagacttg---------------------------------
A0A8C6HE78_BIK-01       --------atagtcttg----tctcctggcgcctg-------------gg
A0A8C6HE78_BIK-02       --------atagtcttg----tctcctggcgcctg-------------gg
A0A8C6HHE2_BBC3-01      --------acggacctcagccctccctgtcaccagcccagcagcacttag
A0A8C6GZK8_BMF-01       cgctggctacaggcttc--ctctccctgccagtttccctgc-------ag
A0A8C6GZK8_BMF-02       cgctggctacaggcttc--ctctccctgccagtttccctgc-------ag
A0A8C6GZK8_BMF-03       cgctggctacaggcttc--ctctccctgccagtttccctgc-------ag
                                       *                                  

A0A8C6HGQ3_BCL2L11      aggaacct---gaagatctgcgcccggagatacggatt------------
A0A8C6HGQ3_BCL2L11      aggaacct---gaagatctgcgcccggagatacggatt------------
A0A8C6HGQ3_BCL2L11      aggaacct---gaagatctgcgcccggagatacggatt------------
A0A8C6IHC9_BAD-01       cgctacggccgtgagctccgaagaatgagcgatgagtttgagggttcctt
A0A8C6HML5_PMAIP1-      --------------------------------------------------
A0A8C6HE78_BIK-01       tgtcacct------gaccaggaccctgggc--------------------
A0A8C6HE78_BIK-02       tgtcacct------gaccaggaccctgggc--------------------
A0A8C6HHE2_BBC3-01      agtcgccc----gtgcccagcgccccggaggccctggcaggaggccccac
A0A8C6GZK8_BMF-01       gctcaccccttggggagcagccccctgaaggac-----------------
A0A8C6GZK8_BMF-02       gctcaccccttggggagcagccccctgaaggac-----------------
A0A8C6GZK8_BMF-03       gctcaccccttggggagcagccccctgaaggac-----------------
                                                                          

A0A8C6HGQ3_BCL2L11      -------------------------------------gcacagga-----
A0A8C6HGQ3_BCL2L11      -------------------------------------gcacagga-----
A0A8C6HGQ3_BCL2L11      -------------------------------------gcacagga-----
A0A8C6IHC9_BAD-01       caagggacttcctcgcccaaagagcgcaggcactgcaacacagat-----
A0A8C6HML5_PMAIP1-      -----------------------------------aaggacgagt-----
A0A8C6HE78_BIK-01       ---ag-------ctgtttc-------------------caatggt-----
A0A8C6HE78_BIK-02       ---ag-------ctgtttc-------------------caatggt-----
A0A8C6HHE2_BBC3-01      ccaag-------ctgccccgggagtgcgtgtggaggaggaggagtgggcc
A0A8C6GZK8_BMF-01       ---ag-------ttccttcagcacc----------gagcagaggt-----
A0A8C6GZK8_BMF-02       ---ag-------ttccttcagcacc----------gagcagaggt-----
A0A8C6GZK8_BMF-03       ---ag-------ttccttcagcacc----------gagcagaggt-----
                                                               *          

A0A8C6HGQ3_BCL2L11      -----------------gctgcggcggatcggagacgagttcaacgaaac
A0A8C6HGQ3_BCL2L11      -----------------gctgcggcggatcggagacgagttcaacgaaac
A0A8C6HGQ3_BCL2L11      -----------------gctgcggcggatcggagacgagttcaacgaaac
A0A8C6IHC9_BAD-01       ---------gcgacaaagctccagc-------------------------
A0A8C6HML5_PMAIP1-      ----------gtgctcaactccggagaattggagacaaagtgaatttacg
A0A8C6HE78_BIK-01       -----------------gctgc----------------------------
A0A8C6HE78_BIK-02       -----------------gctgc----------------------------
A0A8C6HHE2_BBC3-01      cgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgca
A0A8C6GZK8_BMF-01       --gcagatcgccagaaagcttcagtgtattgcagaccagttccatcggct
A0A8C6GZK8_BMF-02       --gcagatcgccagaaagcttcagtgtattgcagaccagttccatcggct
A0A8C6GZK8_BMF-03       --gcagatcgccagaaagcttcagtgtattgcagaccagttccatcggct
                                          ** *                            

A0A8C6HGQ3_BCL2L11      ttacacaaggagggtgtttgcaaatgattaccgcgaggctgaa---gacc
A0A8C6HGQ3_BCL2L11      ttacacaaggagggtaaggacctctccccatccccagagaaagtgcgact
A0A8C6HGQ3_BCL2L11      ttacacaaggagggtaaggacctctccccatccccagagaaagtgcgact
A0A8C6IHC9_BAD-01       -------------------------------------------------t
A0A8C6HML5_PMAIP1-      gcagaaactt---------------------------------------c
A0A8C6HE78_BIK-01       -------------------------------------------------t
A0A8C6HE78_BIK-02       -------------------------------------------------t
A0A8C6HHE2_BBC3-01      gtacgagcggcggagacaagaagagcagcatcgacaccgaccctcaccct
A0A8C6GZK8_BMF-01       tcatacgc------aacaacaccagcagaaccgagaccgtgcgtgg---t
A0A8C6GZK8_BMF-02       tcatacgc------aacaacaccagcagaaccgagaccgtgcgtgg---t
A0A8C6GZK8_BMF-03       tcatacgc------aacaacaccagcagaaccgagaccgtgcgtgg---t
                                                                          

A0A8C6HGQ3_BCL2L11      accctcaaatggttatcttacaactgttacgctttatcttccgtctggta
A0A8C6HGQ3_BCL2L11      gcggagatatggcccccttctgcaccttacg--ttatctctctcctaatt
A0A8C6HGQ3_BCL2L11      gcggagatatggcccccttctgcaccttacg--ttatctctctcctaatt
A0A8C6IHC9_BAD-01       ggacgcgcattatccagtcct---------------------------gg
A0A8C6HML5_PMAIP1-      tgaatttgatttccaagctcttc---------------------------
A0A8C6HE78_BIK-01       gg----------------tcttcttg------------ctgctggg----
A0A8C6HE78_BIK-02       gg----------------tcttcttg------------ctgctggg----
A0A8C6HHE2_BBC3-01      ggagggtcatgtacaatctcttcatgggactcctccccttacccag----
A0A8C6GZK8_BMF-01       ggcaggtctt------cctcttccttcaaaacctcgccctgaacagacaa
A0A8C6GZK8_BMF-02       ggcaggtctt------cctcttccttcaaaacctcgccctgaacagacaa
A0A8C6GZK8_BMF-03       ggcaggtctt------cctcttccttcaaaacctcgccctgaacagacaa
                                                                          

A0A8C6HGQ3_BCL2L11      tggagaagg------------------------------cattga
A0A8C6HGQ3_BCL2L11      ctgctctga------------------------------c-ctga
A0A8C6HGQ3_BCL2L11      ctgctctga------------------------------c-ctga
A0A8C6IHC9_BAD-01       tgggatcgaaacttgggcaaaggagactccaccccctcccagtga
A0A8C6HML5_PMAIP1-      -aatttagtaacctga-----------------------------
A0A8C6HE78_BIK-01       ------tggggcctggtatttgcag-----------cttcagtga
A0A8C6HE78_BIK-02       ------tggggcctggtatttgcag-----------cttcagtga
A0A8C6HHE2_BBC3-01      ggatcctggagccccagaaatggag-----------cccaactag
A0A8C6GZK8_BMF-01       gaaaacaggga----aggggtgggg-----------ccctggtga
A0A8C6GZK8_BMF-02       gaaaacaggga----aggggtgggg-----------ccctggtga
A0A8C6GZK8_BMF-03       gaaaacaggga----aggggtgggg-----------ccctggtga
                               *                                     

© 1998-2022Legal notice