Dataset for CDS BIK of organism Mus spicilegus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C6HE78_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Mus spicilegus GN=BIK (length=477 residues).
atgtcggaggcgagacttatggccagagacgtcatcaagactgttccacacgaccaggtcccccaacctccagtggcctc
tgagactcccagcatgaaggagcctgtggctggggaaaaccttagtcctgtgagagacgtggacctcatggagtgcgtgg
aaggcagaaaccaggtggccttgaggctggcctgcattggcgatgagatggacctgtgtctgcggagcccccgtctggtc
cagctgcctgggattgctatacacagactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagcttgat
tcgaagtctcaccaacctcagggaaaacatctggtcctggatagtcttgtctcctggcgcctgggtgtcacctgaccagg
accctgggcagctgtttccaatggtgctgctggtcttcttgctgctgggtggggcctggtatttgcagcttcagtga
>gnl|bcl2dbcds|A0A8C6HE78_BIK-02 BCL2-interacting killer gene OS=[Eukaryota] Mus spicilegus GN=BIK (length=321 residues).
aagttcactagaaaccaggtggccttgaggctggcctgcattggcgatgagatggacctgtgtctgcggagcccccgtct
ggtccagctgcctgggattgctatacacagactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagct
tgattcgaagtctcaccaacctcagggaaaacatctggtcctggatagtcttgtctcctggcgcctgggtgtcacctgac
caggaccctgggcagctgtttccaatggtgctgctggtcttcttgctgctgggtggggcctggtatttgcagcttcagtg
a
© 1998-2022Legal notice