Dataset for CDS BIK of organism Mus spicilegus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6HE78_BIK-01      atgtcggaggcgagacttatggccagagacgtcatcaagactgttccaca
A0A8C6HE78_BIK-02      --------------------------------------------------
                                                                         

A0A8C6HE78_BIK-01      cgaccaggtcccccaacctccagtggcctctgagactcccagcatgaagg
A0A8C6HE78_BIK-02      -----aagttcac-------------------------------------
                            * ** * *                                     

A0A8C6HE78_BIK-01      agcctgtggctggggaaaaccttagtcctgtgagagacgtggacctcatg
A0A8C6HE78_BIK-02      --------------------------------------------------
                                                                         

A0A8C6HE78_BIK-01      gagtgcgtggaaggcagaaaccaggtggccttgaggctggcctgcattgg
A0A8C6HE78_BIK-02      --------------tagaaaccaggtggccttgaggctggcctgcattgg
                                      ***********************************

A0A8C6HE78_BIK-01      cgatgagatggacctgtgtctgcggagcccccgtctggtccagctgcctg
A0A8C6HE78_BIK-02      cgatgagatggacctgtgtctgcggagcccccgtctggtccagctgcctg
                       **************************************************

A0A8C6HE78_BIK-01      ggattgctatacacagactcgctgtcacctacagccggacaggtgtcaga
A0A8C6HE78_BIK-02      ggattgctatacacagactcgctgtcacctacagccggacaggtgtcaga
                       **************************************************

A0A8C6HE78_BIK-01      ggtattttcaggagcttgattcgaagtctcaccaacctcagggaaaacat
A0A8C6HE78_BIK-02      ggtattttcaggagcttgattcgaagtctcaccaacctcagggaaaacat
                       **************************************************

A0A8C6HE78_BIK-01      ctggtcctggatagtcttgtctcctggcgcctgggtgtcacctgaccagg
A0A8C6HE78_BIK-02      ctggtcctggatagtcttgtctcctggcgcctgggtgtcacctgaccagg
                       **************************************************

A0A8C6HE78_BIK-01      accctgggcagctgtttccaatggtgctgctggtcttcttgctgctgggt
A0A8C6HE78_BIK-02      accctgggcagctgtttccaatggtgctgctggtcttcttgctgctgggt
                       **************************************************

A0A8C6HE78_BIK-01      ggggcctggtatttgcagcttcagtga
A0A8C6HE78_BIK-02      ggggcctggtatttgcagcttcagtga
                       ***************************

© 1998-2022Legal notice