Dataset for CDS BCL2L11 of organism Mus spicilegus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C6HGQ3_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Mus spicilegus GN=BCL2L11 (length=813 residues).
atgatcccggcggcggccggtgcagcgcgggccagaggcgcggcgcgcgaaaccttcggctccccggcggagcgtggcgg
agggcggacgggcaggcgcggggccctggagcccaggacccggctttgtttcccttgcctcctcggtggcgacgtgcagg
ggtcgttcgatcggcgcaacacgccgcgctcggaagggaaggggcggacaaaaaaagaccaaatggccaagcaaccttct
gatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctccccagctcaggcctggggcccc
tacctccctacagacagaaccgcaaggtaatcccgacggcgaaggggaccgctgcccccacggcagccctcagggcccgc
tggccccaccggccagccctggcccttttgctaccagatccccacttttcatctttgtgagaagatcttctctgctgtcc
cggtcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtgacaagtcaacacaaacccc
aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccataagacagtctcaggaggaacctgaagatc
tgcgcccggagatacggattgcacaggagctgcggcggatcggagacgagttcaacgaaacttacacaaggagggtaagg
acctctccccatccccagagaaagtgcgactgcggagatatggcccccttctgcaccttacgttatctctctcctaattc
tgctctgacctga
>gnl|bcl2dbcds|A0A8C6HGQ3_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Mus spicilegus GN=BCL2L11 (length=675 residues).
atgattttaaaacttaatttgctgaagataatcgttttgttgtgccccccccccaccctgtttccttgcagaaaaaaaga
ccaaatggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctc
cccagctcaggcctggggcccctacctccctacagacagaaccgcaaggtaatcccgacggcgaaggggaccgctgcccc
cacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccacttttcatctttgt
gagaagatcttctctgctgtcccggtcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagtt
gtgacaagtcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccataagacag
tctcaggaggaacctgaagatctgcgcccggagatacggattgcacaggagctgcggcggatcggagacgagttcaacga
aacttacacaaggagggtgtttgcaaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaactgttac
gctttatcttccgtctggtatggagaaggcattga
>gnl|bcl2dbcds|A0A8C6HGQ3_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Mus spicilegus GN=BCL2L11 (length=645 residues).
atgatcccggcggcggccggtgcagcgcgggccagaggcgcggcgcgcgaaaccttcggctccccggcggagcgtggcgg
agggcggacgggcaggcgcggggccctggagcccaggacccggctttgtttcccttgcctcctcggtggcgacgtgcagg
ggtcgttcgatcggcgcaacacgccgcgctcggaagggaaggggcggacaaaaaaagaccaaatggccaagcaaccttct
gatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctccccagctcaggcctggggcccc
tacctccctacagacagaaccgcaagacaggagcccggcacccatgagttgtgacaagtcaacacaaaccccaagtcctc
cttgccaggccttcaaccactatctcagtgcaatggcttccataagacagtctcaggaggaacctgaagatctgcgcccg
gagatacggattgcacaggagctgcggcggatcggagacgagttcaacgaaacttacacaaggagggtaaggacctctcc
ccatccccagagaaagtgcgactgcggagatatggcccccttctgcaccttacgttatctctctcctaattctgctctga
cctga
© 1998-2022Legal notice