Dataset for CDS BCL2L11 of organism Mus spicilegus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6HGQ3_BCL2L11      atgatttt-----------------------------------------a
A0A8C6HGQ3_BCL2L11      atgatcccggcggcggccggtgcagcgcgggccagaggcgcggcgcgcga
A0A8C6HGQ3_BCL2L11      atgatcccggcggcggccggtgcagcgcgggccagaggcgcggcgcgcga
                        *****                                            *

A0A8C6HGQ3_BCL2L11      aaacttaattt---------------gctgaagataatcgttttgttgtg
A0A8C6HGQ3_BCL2L11      aaccttcggctccccggcggagcgtggcggagggcggacgggcaggcgcg
A0A8C6HGQ3_BCL2L11      aaccttcggctccccggcggagcgtggcggagggcggacgggcaggcgcg
                        ** ***    *               ** ** *     **    *  * *

A0A8C6HGQ3_BCL2L11      cccccc------------ccccaccctgtttcct----------------
A0A8C6HGQ3_BCL2L11      gggccctggagcccaggacccggctttgtttcccttgcctcctcggtggc
A0A8C6HGQ3_BCL2L11      gggccctggagcccaggacccggctttgtttcccttgcctcctcggtggc
                           ***            ***  *  *******                 

A0A8C6HGQ3_BCL2L11      ----tgcag-----------------------------------------
A0A8C6HGQ3_BCL2L11      gacgtgcaggggtcgttcgatcggcgcaacacgccgcgctcggaagggaa
A0A8C6HGQ3_BCL2L11      gacgtgcaggggtcgttcgatcggcgcaacacgccgcgctcggaagggaa
                            *****                                         

A0A8C6HGQ3_BCL2L11      ---------aaaaaaagaccaaatggccaagcaaccttctgatgtaagtt
A0A8C6HGQ3_BCL2L11      ggggcggacaaaaaaagaccaaatggccaagcaaccttctgatgtaagtt
A0A8C6HGQ3_BCL2L11      ggggcggacaaaaaaagaccaaatggccaagcaaccttctgatgtaagtt
                                 *****************************************

A0A8C6HGQ3_BCL2L11      ctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctccc
A0A8C6HGQ3_BCL2L11      ctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctccc
A0A8C6HGQ3_BCL2L11      ctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctccc
                        **************************************************

A0A8C6HGQ3_BCL2L11      cagctcaggcctggggcccctacctccctacagacagaaccgcaaggtaa
A0A8C6HGQ3_BCL2L11      cagctcaggcctggggcccctacctccctacagacagaaccgcaaggtaa
A0A8C6HGQ3_BCL2L11      cagctcaggcctggggcccctacctccctacagacagaaccgca------
                        ********************************************      

A0A8C6HGQ3_BCL2L11      tcccgacggcgaaggggaccgctgcccccacggcagccctcagggcccgc
A0A8C6HGQ3_BCL2L11      tcccgacggcgaaggggaccgctgcccccacggcagccctcagggcccgc
A0A8C6HGQ3_BCL2L11      --------------------------------------------------
                                                                          

A0A8C6HGQ3_BCL2L11      tggccccaccggccagccctggcccttttgctaccagatccccacttttc
A0A8C6HGQ3_BCL2L11      tggccccaccggccagccctggcccttttgctaccagatccccacttttc
A0A8C6HGQ3_BCL2L11      --------------------------------------------------
                                                                          

A0A8C6HGQ3_BCL2L11      atctttgtgagaagatcttctctgctgtcccggtcctccagtgggtattt
A0A8C6HGQ3_BCL2L11      atctttgtgagaagatcttctctgctgtcccggtcctccagtgggtattt
A0A8C6HGQ3_BCL2L11      --------------------------------------------------
                                                                          

A0A8C6HGQ3_BCL2L11      ctcttttgacacagacaggagcccggcacccatgagttgtgacaagtcaa
A0A8C6HGQ3_BCL2L11      ctcttttgacacagacaggagcccggcacccatgagttgtgacaagtcaa
A0A8C6HGQ3_BCL2L11      ------------agacaggagcccggcacccatgagttgtgacaagtcaa
                                    **************************************

A0A8C6HGQ3_BCL2L11      cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgca
A0A8C6HGQ3_BCL2L11      cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgca
A0A8C6HGQ3_BCL2L11      cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgca
                        **************************************************

A0A8C6HGQ3_BCL2L11      atggcttccataagacagtctcaggaggaacctgaagatctgcgcccgga
A0A8C6HGQ3_BCL2L11      atggcttccataagacagtctcaggaggaacctgaagatctgcgcccgga
A0A8C6HGQ3_BCL2L11      atggcttccataagacagtctcaggaggaacctgaagatctgcgcccgga
                        **************************************************

A0A8C6HGQ3_BCL2L11      gatacggattgcacaggagctgcggcggatcggagacgagttcaacgaaa
A0A8C6HGQ3_BCL2L11      gatacggattgcacaggagctgcggcggatcggagacgagttcaacgaaa
A0A8C6HGQ3_BCL2L11      gatacggattgcacaggagctgcggcggatcggagacgagttcaacgaaa
                        **************************************************

A0A8C6HGQ3_BCL2L11      cttacacaaggagggtgtttgcaaatgattaccgcgaggctgaa---gac
A0A8C6HGQ3_BCL2L11      cttacacaaggagggtaaggacctctccccatccccagagaaagtgcgac
A0A8C6HGQ3_BCL2L11      cttacacaaggagggtaaggacctctccccatccccagagaaagtgcgac
                        ****************     *   *    * * * **    *    ***

A0A8C6HGQ3_BCL2L11      caccctcaaatggttatcttacaactgttacgctttatcttccgtctggt
A0A8C6HGQ3_BCL2L11      tgcggagatatggcccccttctgcaccttacg--ttatctctctcctaat
A0A8C6HGQ3_BCL2L11      tgcggagatatggcccccttctgcaccttacg--ttatctctctcctaat
                          *    * ****    ***       *****  ******  *  **  *

A0A8C6HGQ3_BCL2L11      atggagaaggcattga
A0A8C6HGQ3_BCL2L11      tctgctctgac-ctga
A0A8C6HGQ3_BCL2L11      tctgctctgac-ctga
                           *    * *  ***

© 1998-2022Legal notice