Dataset for CDS PMAIP1 of organism Mus musculus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|Q9JM54_PMAIP1-03 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Mus musculus GN=PMAIP1 (length=165 residues).
atgcctgggaagtcgcaaaagagcaggatgaggagcccaagcccaacccgggtgccagcagacttgaaggacgagtgtgc
tcaactccggaggattggagacaaagtgaatttacggcagaaacttctgaatttgatttccaagctcttcaatttagtaa
cctga
>gnl|bcl2dbcds|Q9JM54_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Mus musculus GN=PMAIP1 (length=312 residues).
atgcccgggagaaaggcgcgtcggaacgcgccagtgaacccaacgcgggcagagctaccacctgagttcgcagctcaact
caggaagatcggagacaaagtgtattgcacgtggagtgcaccggacataactgtggttctggcgcagatgcctgggaagt
cgcaaaagagcaggatgaggagcccaagcccaacccgggtgccagcagacttgaaggacgagtgtgctcaactccggagg
attggagacaaagtgaatttacggcagaaacttctgaatttgatttccaagctcttcaatttagtaacctga
>gnl|bcl2dbcds|Q9JM54_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Mus musculus GN=PMAIP1 (length=156 residues).
atgcccgggagaaaggcgcgtcggaacgcgccagtgaacccaacgcgggcagacttgaaggacgagtgtgctcaactccg
gaggattggagacaaagtgaatttacggcagaaacttctgaatttgatttccaagctcttcaatttagtaacctga
© 1998-2020Legal notice