Dataset for CDS PMAIP1 of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q9JM54_PMAIP1-03      atgcctggga----------------------------------------
Q9JM54_PMAIP1-01      atgcccgggagaaaggcgcgtcggaacgcgccagtgaacccaacgcgggc
Q9JM54_PMAIP1-02      atgcccgggagaaaggcgcgtcggaacgcgccagtgaacccaacgcgg--
                      ***** ****                                        

Q9JM54_PMAIP1-03      --------------------------------------------------
Q9JM54_PMAIP1-01      agagctaccacctgagttcgcagctcaactcaggaagatcggagacaaag
Q9JM54_PMAIP1-02      --------------------------------------------------
                                                                        

Q9JM54_PMAIP1-03      --------------------------------------------------
Q9JM54_PMAIP1-01      tgtattgcacgtggagtgcaccggacataactgtggttctggcgcagatg
Q9JM54_PMAIP1-02      --------------------------------------------------
                                                                        

Q9JM54_PMAIP1-03      -------agtcgcaaaagagcaggatgaggagcccaagcccaacccgggt
Q9JM54_PMAIP1-01      cctgggaagtcgcaaaagagcaggatgaggagcccaagcccaacccgggt
Q9JM54_PMAIP1-02      --------------------------------------------------
                                                                        

Q9JM54_PMAIP1-03      gccagcagacttgaaggacgagtgtgctcaactccggaggattggagaca
Q9JM54_PMAIP1-01      gccagcagacttgaaggacgagtgtgctcaactccggaggattggagaca
Q9JM54_PMAIP1-02      ----gcagacttgaaggacgagtgtgctcaactccggaggattggagaca
                          **********************************************

Q9JM54_PMAIP1-03      aagtgaatttacggcagaaacttctgaatttgatttccaagctcttcaat
Q9JM54_PMAIP1-01      aagtgaatttacggcagaaacttctgaatttgatttccaagctcttcaat
Q9JM54_PMAIP1-02      aagtgaatttacggcagaaacttctgaatttgatttccaagctcttcaat
                      **************************************************

Q9JM54_PMAIP1-03      ttagtaacctga
Q9JM54_PMAIP1-01      ttagtaacctga
Q9JM54_PMAIP1-02      ttagtaacctga
                      ************

© 1998-2022Legal notice