Dataset for CDS PMAIP1 of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q9JM54_PMAIP1-01      atgcccgggagaaaggcgcgtcggaacgcgccagtgaacccaacgcgggc
Q9JM54_PMAIP1-03      --------------------------------------------------

Q9JM54_PMAIP1-01      agagctaccacctgagttcgcagctcaactcaggaagatcggagacaaag
Q9JM54_PMAIP1-03      --------------------------------------------------

Q9JM54_PMAIP1-01      tgtattgcacgtggagtgcaccggacataactgtggttctggcgcagatg
Q9JM54_PMAIP1-03      -----------------------------------------------atg

Q9JM54_PMAIP1-01      cctgggaagtcgcaaaagagcaggatgaggagcccaagcccaacccgggt
Q9JM54_PMAIP1-03      cctgggaagtcgcaaaagagcaggatgaggagcccaagcccaacccgggt

Q9JM54_PMAIP1-01      gccagcagacttgaaggacgagtgtgctcaactccggaggattggagaca
Q9JM54_PMAIP1-03      gccagcagacttgaaggacgagtgtgctcaactccggaggattggagaca

Q9JM54_PMAIP1-01      aagtgaatttacggcagaaacttctgaatttgatttccaagctcttcaat
Q9JM54_PMAIP1-03      aagtgaatttacggcagaaacttctgaatttgatttccaagctcttcaat

Q9JM54_PMAIP1-01      ttagtaacctga
Q9JM54_PMAIP1-03      ttagtaacctga

© 1998-2020Legal notice