Dataset for CDS BBC3 of organism Mus musculus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|B2RVL4_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Mus musculus GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctctccggagcccgtagagggtctagcccgcgacagtccgcgccccttcccgct
cggccgcctgatgccctccgctgtatcctgcagcctttgcgagcccggcctgcccgccgcccctgctgcccctgccttgc
tgccggccgcctacctctgcgcccccaccgctccacctgccgtcaccgccgccctggggggcccccgctggcctgggggt
caccgcagccggcccagaggcccgcgcccggacggtcctcagccctccctgtcaccagcccagcagcacttagagtcgcc
cgtgcccagcgccccggaggccctggcaggaggccccacccaagctgccccgggagtgcgtgtggaggaggaggagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcag
catcgacaccgaccctcaccctggagggtcatgtacaatctcttcatgggactcctccccttacccagggatcctggagc
cccagaaatggagcccaactag
>gnl|bcl2dbcds|Q99ML1_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Mus musculus GN=BBC3 (length=386 residues).
atggcccgcgcacgccaggagggcagctctccggagcccgtagagggtctagcccgcgacagtccgcgccccttcccgct
cggccgcctgatgccctccgctgtatcctgcagcctttgcgagcccggcctgcccgccgcccctgctgcccctgccttgc
tgccggccgcctacctctgcgcccccaccgctccacctgccgtcaccgccgccctggggggcccccgctggcctgggggt
caccgcagccggcccagaggcccgcgcccggacggtcctcagccctccctgtcaccagcccagcagcacttagagtcgcc
cgtgcccagcgccccggaggccctggcaggaggccccacccaagctgccccgggagtgcgtgtgga
>gnl|bcl2dbcds|Q99ML1_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Mus musculus GN=BBC3 (length=274 residues).
atggcccgcgcacgccaggagggcagctctccggagcccgtagagggtctagcccgcgacagtccgcgccccttcccgct
cggccgcctgatgccctccgctgtatcctgcagcctttgcgagcccggcctgcccgccgcccctgctgcccctgccttgc
tgccggccgcctacctctgcgcccccaccgctccacctgccgtcaccgccgccctggggggcccccgctggcctgggggt
caccgcagccggcccagaggcccgcgcccggacg
>gnl|bcl2dbcds|Q99ML1_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Mus musculus GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctctccggagcccgtagagggtctagcccgcgacagtccgcgccccttcccgct
cggccgcctgatgccctccgctgtatcctgcagcctttgcgagcccggcctgcccgccgcccctgctgcccctgccttgc
tgccggccgcctacctctgcgcccccaccgctccacctgccgtcaccgccgccctggggggcccccgctggcctgggggt
caccgcagccggcccagaggcccgcgcccggacggtcctcagccctccctgtcaccagcccagcagcacttagagtcgcc
cgtgcccagcgccccggaggccctggcaggaggccccacccaagctgccccgggagtgcgtgtggaggaggaggagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcag
catcgacaccgaccctcaccctggagggtcatgtacaatctcttcatgggactcctccccttacccagggatcctggagc
cccagaaatggagcccaactag
© 1998-2020Legal notice