Dataset for CDS BBC3 of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


B2RVL4_BBC3-01      atggcccgcgcacgccaggagggcagctctccggagcccgtagagggtctagcccgcgac
Q99ML1_BBC3-03      atggcccgcgcacgccaggagggcagctctccggagcccgtagagggtctagcccgcgac
Q99ML1_BBC3-01      atggcccgcgcacgccaggagggcagctctccggagcccgtagagggtctagcccgcgac
Q99ML1_BBC3-02      atggcccgcgcacgccaggagggcagctctccggagcccgtagagggtctagcccgcgac
                    ************************************************************

B2RVL4_BBC3-01      agtccgcgccccttcccgctcggccgcctgatgccctccgctgtatcctgcagcctttgc
Q99ML1_BBC3-03      agtccgcgccccttcccgctcggccgcctgatgccctccgctgtatcctgcagcctttgc
Q99ML1_BBC3-01      agtccgcgccccttcccgctcggccgcctgatgccctccgctgtatcctgcagcctttgc
Q99ML1_BBC3-02      agtccgcgccccttcccgctcggccgcctgatgccctccgctgtatcctgcagcctttgc
                    ************************************************************

B2RVL4_BBC3-01      gagcccggcctgcccgccgcccctgctgcccctgccttgctgccggccgcctacctctgc
Q99ML1_BBC3-03      gagcccggcctgcccgccgcccctgctgcccctgccttgctgccggccgcctacctctgc
Q99ML1_BBC3-01      gagcccggcctgcccgccgcccctgctgcccctgccttgctgccggccgcctacctctgc
Q99ML1_BBC3-02      gagcccggcctgcccgccgcccctgctgcccctgccttgctgccggccgcctacctctgc
                    ************************************************************

B2RVL4_BBC3-01      gcccccaccgctccacctgccgtcaccgccgccctggggggcccccgctggcctgggggt
Q99ML1_BBC3-03      gcccccaccgctccacctgccgtcaccgccgccctggggggcccccgctggcctgggggt
Q99ML1_BBC3-01      gcccccaccgctccacctgccgtcaccgccgccctggggggcccccgctggcctgggggt
Q99ML1_BBC3-02      gcccccaccgctccacctgccgtcaccgccgccctggggggcccccgctggcctgggggt
                    ************************************************************

B2RVL4_BBC3-01      caccgcagccggcccagaggcccgcgcccggacggtcctcagccctccctgtcaccagcc
Q99ML1_BBC3-03      caccgcagccggcccagaggcccgcgcccggacggtcctcagccctccctgtcaccagcc
Q99ML1_BBC3-01      caccgcagccggcccagaggcccgcgcccggacg--------------------------
Q99ML1_BBC3-02      caccgcagccggcccagaggcccgcgcccggacggtcctcagccctccctgtcaccagcc
                    **********************************                          

B2RVL4_BBC3-01      cagcagcacttagagtcgcccgtgcccagcgccccggaggccctggcaggaggccccacc
Q99ML1_BBC3-03      cagcagcacttagagtcgcccgtgcccagcgccccggaggccctggcaggaggccccacc
Q99ML1_BBC3-01      ------------------------------------------------------------
Q99ML1_BBC3-02      cagcagcacttagagtcgcccgtgcccagcgccccggaggccctggcaggaggccccacc
                                                                                

B2RVL4_BBC3-01      caagctgccccgggagtgcgtgtggaggaggaggagtgggcccgggagatcggggcccag
Q99ML1_BBC3-03      caagctgccccgggagtgcgtgtgga----------------------------------
Q99ML1_BBC3-01      ------------------------------------------------------------
Q99ML1_BBC3-02      caagctgccccgggagtgcgtgtggaggaggaggagtgggcccgggagatcggggcccag
                                                                                

B2RVL4_BBC3-01      ctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcag
Q99ML1_BBC3-03      ------------------------------------------------------------
Q99ML1_BBC3-01      ------------------------------------------------------------
Q99ML1_BBC3-02      ctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcag
                                                                                

B2RVL4_BBC3-01      catcgacaccgaccctcaccctggagggtcatgtacaatctcttcatgggactcctcccc
Q99ML1_BBC3-03      ------------------------------------------------------------
Q99ML1_BBC3-01      ------------------------------------------------------------
Q99ML1_BBC3-02      catcgacaccgaccctcaccctggagggtcatgtacaatctcttcatgggactcctcccc
                                                                                

B2RVL4_BBC3-01      ttacccagggatcctggagccccagaaatggagcccaactag
Q99ML1_BBC3-03      ------------------------------------------
Q99ML1_BBC3-01      ------------------------------------------
Q99ML1_BBC3-02      ttacccagggatcctggagccccagaaatggagcccaactag
                                                              

© 1998-2020Legal notice