Dataset for CDS classical BH3-containing proteins of organism Moschus moschiferus

[Download (right click)] [Alignment] [Repertoires]

12 sequence(s)

>gnl|bcl2dbcds|A0A8C6CNS6_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Moschus moschiferus GN=PMAIP1 (length=165 residues).
atgcctggaaggagggctcgcaggagcgcccagctgagccccgcgcgggtcccggcagatcctgaagttgagtgtgccat
tcagttgaggagaattggagacaaactgaatttccggcagaaacttgtgaatctgatatccaaactcctccgctcaggaa
cttga
>gnl|bcl2dbcds|A0A8C6CSS1_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Moschus moschiferus GN=BBC3 (length=396 residues).
gtgagagccacggcagaggctgcccgggcatgtccgtgccagctgccccgggctttcttctccctctgggtcccccacca
gattcgtggtcctcagccttcactctcgcccgcggagcagcacctggaatcgccagtgcccagcgctccgggggccctgg
cgggcggccccacccaagcggccccgggagtccggggggaggaggagcagtgggcccgagagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgctgtacgagcggcggagacaagaggagcaacagcgacaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgcccttccccgggggccgtggagcccccgaggtggagcccaattag
>gnl|bcl2dbcds|A0A8C6CSS1_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Moschus moschiferus GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cagccgcctggtgccctcggcggtgtcctgcggcctctgcgaacccggcctgcctgctgcccccgccgcccccgccctgc
tgcccgccgcctacctctgcgcccctaccaccccgcccgccgtcaccgccgccctgggggccccccgctggcctgggggt
ccccgcagccggccccgaggtccgcgacccgacggtcctcagccttcactctcgcccgcggagcagcacctggaatcgcc
agtgcccagcgctccgggggccctggcgggcggccccacccaagcggccccgggagtccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggcggacgacctcaacgcgctgtacgagcggcggagacaagaggagcaa
cagcgacaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctgcccttccccgggggccgtggagc
ccccgaggtggagcccaattag
>gnl|bcl2dbcds|A0A8C6CWP8_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Moschus moschiferus GN=BMF (length=555 residues).
atggagccaccccagtgtgtggaggagctggaggatgacgtattccagccagaggatggggagccggggacccagcccag
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggctacccagactctcagcccagcttccccgagccag
ggtgttatgctgccttgtggggtgactgaggagccccagcgactcttttatggcaatgctggctaccggctcccccttcc
tgccagtttccctgcaggcttgccccttggtgagcaaccccctgaagggcagtggcaacatcgagcagagatacagattg
cccgaaaactccagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctacacaacgtcgctttgaatggagatgagaacaggaacggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A8C6D4Q6_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Moschus moschiferus GN=PMAIP1 (length=165 residues).
atgcctggaaggagggctcgcaggagcgcccagccgagccccgcgcgggatcaacgagatcctgaagttgagtgtgccat
tcagttgaggagaattggagacaaactgaatttccggcagaaacttgtgaatctgatatccaaactcctccgctcaggaa
cttga
>gnl|bcl2dbcds|A0A8C6DRY6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Moschus moschiferus GN=BCL2L11 (length=585 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgcggagaggcctcctca
gctcagaccgggggctcccacctctttacagacagagcggcaaggtaatcctgaagaaggggaccgctgcccccaaggca
gcccacagggcccgctggccccaccggccagccccggccccttcgctaccagatccccgctcttcatcttcgtgagaaga
tcctccttgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtgacaa
atctacacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcagg
ctgtacctgcagatacacgcccagagatatggatcgcccaggagctacggcgtatcggagacgagtttaatgcatattac
ccaagaagggtcttcgtgcatcaccaggcagctgcgggccacccacaaatggttctcttgcgcgtcttgcgctaccttgt
gcgcctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A8C6DRY6_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Moschus moschiferus GN=BCL2L11 (length=501 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgcggagaggcctcctca
gctcagaccgggggctcccacctctttacagacagagcggcaaggtaatcctgaagaaggggaccgctgcccccaaggca
gcccacagggcccgctggccccaccggccagccccggccccttcgctaccagatccccgctcttcatcttcgtgagaaga
tcctccttgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtgacaa
atctacacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcagg
ctgtacctgcagatacacgcccagagatatggatcgcccaggagctacggcgtatcggagacgagtttaatgcatattac
ccaagaaggttagagccccag
>gnl|bcl2dbcds|A0A8C6DRY6_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Moschus moschiferus GN=BCL2L11 (length=420 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgcggagaggcctcctca
gctcagaccgggggctcccacctctttacagacagagcggcaagacaggagcccggcacccatgagttgtgacaaatcta
cacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgta
cctgcagatacacgcccagagatatggatcgcccaggagctacggcgtatcggagacgagtttaatgcatattacccaag
aagggtcttcgtgcatcaccaggcagctgcgggccacccacaaatggttctcttgcgcgtcttgcgctaccttgtgcgcc
tggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A8C6E5X8_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Moschus moschiferus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcgggcccccggccgtgtgcgcctgcagcgccggccgcctgggtctgcgctc
gtccgccgcgcagctcacggccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccctacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A8C6ECQ4_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Moschus moschiferus GN=PMAIP1 (length=165 residues).
atgcctggaagaagggctcgtagaagcgcccagccgagccccacgcgggtcccggcagatcctgaagttgagtgcgccat
tcagtggaggagaattggagacaaactgaatttccggcagaaacttgtgaatctgatatccaaactcctccgctcaggca
cttga
>gnl|bcl2dbcds|A0A8C6FXQ6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Moschus moschiferus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcagagtgagcaggaagactccagccctgcagataggggcctgggccccagccccac
aggggacgggcccccaggtctcagcaagcactggctaacagccccaggcctcctgggggaagctggtcaccagcaggggc
agtcggccggcagcagccaccatggaggcactggggctgtggagacccggagtcgtcacagctcctaccccgcggggcca
gaggatgatgaagggacggaggaggaggatctcggccccttcaggggccgctcgcgctcggcgccccccaacctatgggc
tgcacagcgatatggccgcgagctccggaggatgagcgacgagtttcacgtctccttcaaggggcttcctcgcccgaaga
gcgcgggcacggcgacgcaaatgcgacaaagccccagctggacgcgcttcctccagtcctggttgagccggaacttgggg
agaggaggctccgccccctcccagtga
>gnl|bcl2dbcds|A0A8C6FY79_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Moschus moschiferus GN=PMAIP1 (length=165 residues).
atgcctggaaggaggtctcgcaggagtgcccagccgagccccgcgcgggtcgcggcagatcctgaagttgagtgtgctat
tcagttgaggagaattggagacaaactgaatttccggcagaaacttgtgaatctgatatccaaactcctccgctcaggaa
cttaa
© 1998-2022Legal notice