Dataset for CDS classical BH3-containing proteins of organism Moschus moschiferus

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6DRY6_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaca---gagaagg
A0A8C6DRY6_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaca---gagaagg
A0A8C6DRY6_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaca---gagaagg
A0A8C6ECQ4_PMAIP1-      at------------------------------------------------
A0A8C6CNS6_PMAIP1-      at------------------------------------------------
A0A8C6D4Q6_PMAIP1-      at------------------------------------------------
A0A8C6FY79_PMAIP1-      at------------------------------------------------
A0A8C6CWP8_BMF-01       atggagccaccccagtgtgtggaggagctggaggatgacgtattccagcc
A0A8C6FXQ6_BAD-01       atgttccagatcccagagtttgagcagagtgagcaggaag-actccagcc
A0A8C6E5X8_HRK-01       atg-----------------------------------------------
A0A8C6CSS1_BBC3-01      gt-----------------------------------------gagagcc
A0A8C6CSS1_BBC3-02      atggcccgagcacgccaggagggcagctccccggagcccg-tagagggcc
                         *                                                

A0A8C6DRY6_BCL2L11      tggacaattgcagcctgcggagaggcctcctcagctcagaccgg---ggg
A0A8C6DRY6_BCL2L11      tggacaattgcagcctgcggagaggcctcctcagctcagaccgg---ggg
A0A8C6DRY6_BCL2L11      tggacaattgcagcctgcggagaggcctcctcagctcagaccgg---ggg
A0A8C6ECQ4_PMAIP1-      ------------gcctggaagaagggctc-----------gtag---aag
A0A8C6CNS6_PMAIP1-      ------------gcctggaaggagggctc-----------gcag---gag
A0A8C6D4Q6_PMAIP1-      ------------gcctggaaggagggctc-----------gcag---gag
A0A8C6FY79_PMAIP1-      ------------gcctggaaggaggtctc-----------gcag---gag
A0A8C6CWP8_BMF-01       agaggatggggagccgg------ggacccagcccaggagcttgctctctg
A0A8C6FXQ6_BAD-01       ctgcagataggggcctg------ggccccagccccacaggggac---ggg
A0A8C6E5X8_HRK-01       -----------tgcccg------tgccccctgcaccgcggccgc---ggg
A0A8C6CSS1_BBC3-01      acggcagaggctgcccg------ggc------------------------
A0A8C6CSS1_BBC3-02      tggcccgcgacggcccg------cgccccttcccgctcagccgcctggtg
                                    *** *       *                         

A0A8C6DRY6_BCL2L11      ctcccacctctttacagacagagcggcaaggtaatcctgaagaaggggac
A0A8C6DRY6_BCL2L11      ctcccacctctttacagacagagcggcaaggtaatcctgaagaaggggac
A0A8C6DRY6_BCL2L11      ctcccacctctttacagacagagcggca----------------------
A0A8C6ECQ4_PMAIP1-      cgcccagcc-----------------------------------------
A0A8C6CNS6_PMAIP1-      cgcccagct-----------------------------------------
A0A8C6D4Q6_PMAIP1-      cgcccagcc-----------------------------------------
A0A8C6FY79_PMAIP1-      tgcccagcc-----------------------------------------
A0A8C6CWP8_BMF-01       ctgacctgtttgcccaga--------------------gccagctggact
A0A8C6FXQ6_BAD-01       cccccaggtctcagcaagcactg---------------gctaacagcccc
A0A8C6E5X8_HRK-01       cccccggccgtgtgc-----------------------gcctgcagcgcc
A0A8C6CSS1_BBC3-01      ---------atgtccg---------------------tgccagctgcccc
A0A8C6CSS1_BBC3-02      ccctcggcggtgtcctgcggcctctgcgaacccggcctgcctgctgcccc
                                                                          

A0A8C6DRY6_BCL2L11      cgct----------------------------------------------
A0A8C6DRY6_BCL2L11      cgct----------------------------------------------
A0A8C6DRY6_BCL2L11      --------------------------------------------------
A0A8C6ECQ4_PMAIP1-      --------------------------------------------------
A0A8C6CNS6_PMAIP1-      --------------------------------------------------
A0A8C6D4Q6_PMAIP1-      --------------------------------------------------
A0A8C6FY79_PMAIP1-      --------------------------------------------------
A0A8C6CWP8_BMF-01       g-------------------------------------------------
A0A8C6FXQ6_BAD-01       ag------------------------------------------------
A0A8C6E5X8_HRK-01       gg------------------------------------------------
A0A8C6CSS1_BBC3-01      gg-----------------------gctttcttct---------------
A0A8C6CSS1_BBC3-02      cgccgcccccgccctgctgcccgccgcctacctctgcgcccctaccaccc
                                                                          

A0A8C6DRY6_BCL2L11      ------------------gcccccaaggcagcccacagggcccgctggcc
A0A8C6DRY6_BCL2L11      ------------------gcccccaaggcagcccacagggcccgctggcc
A0A8C6DRY6_BCL2L11      --------------------------------------------------
A0A8C6ECQ4_PMAIP1-      --------------------------------------------------
A0A8C6CNS6_PMAIP1-      --------------------------------------------------
A0A8C6D4Q6_PMAIP1-      --------------------------------------------------
A0A8C6FY79_PMAIP1-      --------------------------------------------------
A0A8C6CWP8_BMF-01       ------------------ccccctcagcc---------------------
A0A8C6FXQ6_BAD-01       -----------------gcctcctggg-----------------------
A0A8C6E5X8_HRK-01       ------------------ccgcctgggtc---------------------
A0A8C6CSS1_BBC3-01      ------------------ccctctgggtcccccacc--------------
A0A8C6CSS1_BBC3-02      cgcccgccgtcaccgccgccctgggggccccccgctggcctgggggtccc
                                                                          

A0A8C6DRY6_BCL2L11      ccaccggccagccccggccccttcgctaccagatccccgctcttcatctt
A0A8C6DRY6_BCL2L11      ccaccggccagccccggccccttcgctaccagatccccgctcttcatctt
A0A8C6DRY6_BCL2L11      --------------------------------------------------
A0A8C6ECQ4_PMAIP1-      --------------------------------------------------
A0A8C6CNS6_PMAIP1-      --------------------------------------------------
A0A8C6D4Q6_PMAIP1-      --------------------------------------------------
A0A8C6FY79_PMAIP1-      --------------------------------------------------
A0A8C6CWP8_BMF-01       -------------------------------gtctgcagctcttccctct
A0A8C6FXQ6_BAD-01       -----------------------ggaagctggtcaccagc-aggggcagt
A0A8C6E5X8_HRK-01       --------------------------------------------tgcgct
A0A8C6CSS1_BBC3-01      --------------agattcg--------tggtcctcagc-cttcactct
A0A8C6CSS1_BBC3-02      cgcagccggccccgaggtccgcgacccgacggtcctcagc-cttcactct
                                                                          

A0A8C6DRY6_BCL2L11      cgtgagaagatcctccttgctgtctcgatcctccagtgggtatttctctt
A0A8C6DRY6_BCL2L11      cgtgagaagatcctccttgctgtctcgatcctccagtgggtatttctctt
A0A8C6DRY6_BCL2L11      --------------------------------------------------
A0A8C6ECQ4_PMAIP1-      --------------------------------------------------
A0A8C6CNS6_PMAIP1-      --------------------------------------------------
A0A8C6D4Q6_PMAIP1-      --------------------------------------------------
A0A8C6FY79_PMAIP1-      --------------------------------------------------
A0A8C6CWP8_BMF-01       cacgcactgctgtggccctgggcttcgacccaccagccag----------
A0A8C6FXQ6_BAD-01       cggccg-----gcagcagccaccatggaggcactggg-------------
A0A8C6E5X8_HRK-01       cgtccgccgc-gcagct-----cacgg--ccgcccg--------------
A0A8C6CSS1_BBC3-01      cgcccgcgga-gcagca-----cctggaatcgccagt-------------
A0A8C6CSS1_BBC3-02      cgcccgcgga-gcagca-----cctggaatcgccagt-------------
                                                                          

A0A8C6DRY6_BCL2L11      ttgacacagacaggagcccggcacccatgagttgt-----gacaaatcta
A0A8C6DRY6_BCL2L11      ttgacacagacaggagcccggcacccatgagttgt-----gacaaatcta
A0A8C6DRY6_BCL2L11      -------agacaggagcccggcacccatgagttgt-----gacaaatcta
A0A8C6ECQ4_PMAIP1-      -------------gagccccacgc----gggtccc-----ggcagat---
A0A8C6CNS6_PMAIP1-      -------------gagccccgcgc----gggtccc-----ggcagat---
A0A8C6D4Q6_PMAIP1-      -------------gagccccgcgc----gggatca-----acgagat---
A0A8C6FY79_PMAIP1-      -------------gagccccgcgc----gggtcgc-----ggcagat---
A0A8C6CWP8_BMF-01       -------------gaagacaaggctacccagactc---------------
A0A8C6FXQ6_BAD-01       ----------------------gctgtggagaccc-----ggagt-----
A0A8C6E5X8_HRK-01       ----------------------gctcaaggcgctc-----ggcga-----
A0A8C6CSS1_BBC3-01      ---------------gcccagcgctccgggggccctggcgggcgg-----
A0A8C6CSS1_BBC3-02      ---------------gcccagcgctccgggggccctggcgggcgg-----
                                               *                          

A0A8C6DRY6_BCL2L11      cacagaccccaagccctccttgccaggccttcaaccattatctcagtgca
A0A8C6DRY6_BCL2L11      cacagaccccaagccctccttgccaggccttcaaccattatctcagtgca
A0A8C6DRY6_BCL2L11      cacagaccccaagccctccttgccaggccttcaaccattatctcagtgca
A0A8C6ECQ4_PMAIP1-      ------cctgaagttgagtgcgcca----ttcagtgg-------aggaga
A0A8C6CNS6_PMAIP1-      ------cctgaagttgagtgtgcca----ttcagttg-------aggaga
A0A8C6D4Q6_PMAIP1-      ------cctgaagttgagtgtgcca----ttcagttg-------aggaga
A0A8C6FY79_PMAIP1-      ------cctgaagttgagtgtgcta----ttcagttg-------aggaga
A0A8C6CWP8_BMF-01       --------tcagcccagcttccccgag---ccagggtgttatgctgcctt
A0A8C6FXQ6_BAD-01       ------cgtcacagctcctaccccgcggggccagaggatgatg-------
A0A8C6E5X8_HRK-01       -------------cgagctgcaccagcgcaccatgtggcggcgccgc---
A0A8C6CSS1_BBC3-01      ------ccccacccaagcggccccgggagtccggggggaggag--ga---
A0A8C6CSS1_BBC3-02      ------ccccacccaagcggccccgggagtccggggggaggag--ga---
                                              *        *                  

A0A8C6DRY6_BCL2L11      atggcttccatgagg----------------------------cagtctc
A0A8C6DRY6_BCL2L11      atggcttccatgagg----------------------------cagtctc
A0A8C6DRY6_BCL2L11      atggcttccatgagg----------------------------cagtctc
A0A8C6ECQ4_PMAIP1-      attg-------gaga----------------------------caaactg
A0A8C6CNS6_PMAIP1-      attg-------gaga----------------------------caaactg
A0A8C6D4Q6_PMAIP1-      attg-------gaga----------------------------caaactg
A0A8C6FY79_PMAIP1-      attg-------gaga----------------------------caaactg
A0A8C6CWP8_BMF-01       gtggggtgactgaggagccccagcgactcttttatggcaatgctggctac
A0A8C6FXQ6_BAD-01       ---aagggacggagg------------------------a-ggaggatct
A0A8C6E5X8_HRK-01       gcgcggagccggagg------------------------gcgccggcgcc
A0A8C6CSS1_BBC3-01      gcagtgggcccgaga------------------------g-atcggggcc
A0A8C6CSS1_BBC3-02      gcagtgggcccgaga------------------------g-atcggggcc
                                   ***                                    

A0A8C6DRY6_BCL2L11      aggctgtacctgcag-----------------atacacgc---ccagaga
A0A8C6DRY6_BCL2L11      aggctgtacctgcag-----------------atacacgc---ccagaga
A0A8C6DRY6_BCL2L11      aggctgtacctgcag-----------------atacacgc---ccagaga
A0A8C6ECQ4_PMAIP1-      aattt---ccggcag-----------------aaacttgtgaatctgata
A0A8C6CNS6_PMAIP1-      aattt---ccggcag-----------------aaacttgtgaatctgata
A0A8C6D4Q6_PMAIP1-      aattt---ccggcag-----------------aaacttgtgaatctgata
A0A8C6FY79_PMAIP1-      aattt---ccggcag-----------------aaacttgtgaatctgata
A0A8C6CWP8_BMF-01       cggct---cccccttcctgccagtttccctgcaggcttgccccttggtga
A0A8C6FXQ6_BAD-01       cggcc---ccttcag-gggccgctcgcgctcggcgccccccaacctatgg
A0A8C6E5X8_HRK-01       cggc----------------------------gcgctc-----cctac--
A0A8C6CSS1_BBC3-01      cagct---gcggcgg-atggcggacgacctcaacgcgc-----tgtacga
A0A8C6CSS1_BBC3-02      cagct---gcggcgg-atggcggacgacctcaacgcgc-----tgtacga
                                                           *              

A0A8C6DRY6_BCL2L11      tatg-------------------ga-----tcg-----------------
A0A8C6DRY6_BCL2L11      tatg-------------------ga-----tcg-----------------
A0A8C6DRY6_BCL2L11      tatg-------------------ga-----tcg-----------------
A0A8C6ECQ4_PMAIP1-      tcca-------------------aactcctccg-----------------
A0A8C6CNS6_PMAIP1-      tcca-------------------aactcctccg-----------------
A0A8C6D4Q6_PMAIP1-      tcca-------------------aactcctccg-----------------
A0A8C6FY79_PMAIP1-      tcca-------------------aactcctccg-----------------
A0A8C6CWP8_BMF-01       gcaac---cccctgaagggcagtggcaacatcgagcagagatacagattg
A0A8C6FXQ6_BAD-01       gctgc----------------acagcgatatgg----------------c
A0A8C6E5X8_HRK-01       ---------------------------ctactg----------------g
A0A8C6CSS1_BBC3-01      gcggcggagacaagaggagcaacagcgacaccg----------------c
A0A8C6CSS1_BBC3-02      gcggcggagacaagaggagcaacagcgacaccg----------------c
                                                        *                 

A0A8C6DRY6_BCL2L11      cccaggagctacggcgt---------atcggagacgagtttaatgcatat
A0A8C6DRY6_BCL2L11      cccaggagctacggcgt---------atcggagacgagtttaatgcatat
A0A8C6DRY6_BCL2L11      cccaggagctacggcgt---------atcggagacgagtttaatgcatat
A0A8C6ECQ4_PMAIP1-      ctcaggcact----------------------------------------
A0A8C6CNS6_PMAIP1-      ctcaggaact----------------------------------------
A0A8C6D4Q6_PMAIP1-      ctcaggaact----------------------------------------
A0A8C6FY79_PMAIP1-      ctcaggaact----------------------------------------
A0A8C6CWP8_BMF-01       cccgaaaactccagtgc---------attgcagaccagttccatcggctt
A0A8C6FXQ6_BAD-01       cgcgagctccggaggatgagcgacgagtttcacgtctccttcaaggggct
A0A8C6E5X8_HRK-01       ccctggctgtgcgcggc---------cgcgca---------ggtgg----
A0A8C6CSS1_BBC3-01      ccctcgccctggagggt---------cctgtacaatctcatcatgggact
A0A8C6CSS1_BBC3-02      ccctcgccctggagggt---------cctgtacaatctcatcatgggact
                        * *                                               

A0A8C6DRY6_BCL2L11      tacccaagaagg------ttagagccccag--------------------
A0A8C6DRY6_BCL2L11      tacccaagaagggtcttcgtgcatcaccaggcagctgcgggccacccaca
A0A8C6DRY6_BCL2L11      tacccaagaagggtcttcgtgcatcaccaggcagctgcgggccacccaca
A0A8C6ECQ4_PMAIP1-      --------------------------------------------------
A0A8C6CNS6_PMAIP1-      --------------------------------------------------
A0A8C6D4Q6_PMAIP1-      --------------------------------------------------
A0A8C6FY79_PMAIP1-      --------------------------------------------------
A0A8C6CWP8_BMF-01       catatgcagcaacaccagcagaaccgaa----------------atcgcg
A0A8C6FXQ6_BAD-01       tcctcgcccgaagagcgcgggcacggcgacgcaaatgcgacaaagcccca
A0A8C6E5X8_HRK-01       ------c-------------------------------------ggcgct
A0A8C6CSS1_BBC3-01      cctgccc-------------------------------------ttcccc
A0A8C6CSS1_BBC3-02      cctgccc-------------------------------------ttcccc
                                                                          

A0A8C6DRY6_BCL2L11      --------------------------------------------------
A0A8C6DRY6_BCL2L11      aatggttctcttgcgcgtcttgcgctaccttgtgcgcctg----------
A0A8C6DRY6_BCL2L11      aatggttctcttgcgcgtcttgcgctaccttgtgcgcctg----------
A0A8C6ECQ4_PMAIP1-      --------------------------------------------------
A0A8C6CNS6_PMAIP1-      --------------------------------------------------
A0A8C6D4Q6_PMAIP1-      --------------------------------------------------
A0A8C6FY79_PMAIP1-      --------------------------------------------------
A0A8C6CWP8_BMF-01       tgtggtggcagatcctcctcttcctacacaacgtcgctttgaatggagat
A0A8C6FXQ6_BAD-01       gctggacgcgcttcctccagtcct--------------------------
A0A8C6E5X8_HRK-01       ggcggcctggctgctcgg--------------------------------
A0A8C6CSS1_BBC3-01      gggggccgtggagccccc--------------------------------
A0A8C6CSS1_BBC3-02      gggggccgtggagccccc--------------------------------
                                                                          

A0A8C6DRY6_BCL2L11      --------------------------------------------------
A0A8C6DRY6_BCL2L11      ------------gtgtggaggatgcagtga--------------------
A0A8C6DRY6_BCL2L11      ------------gtgtggaggatgcagtga--------------------
A0A8C6ECQ4_PMAIP1-      ---------------------------tga--------------------
A0A8C6CNS6_PMAIP1-      ---------------------------tga--------------------
A0A8C6D4Q6_PMAIP1-      ---------------------------tga--------------------
A0A8C6FY79_PMAIP1-      ---------------------------taa--------------------
A0A8C6CWP8_BMF-01       gagaacaggaacggggcaggtcccaggtga--------------------
A0A8C6FXQ6_BAD-01       --------ggttgagccggaacttggggagaggaggctccgccccctccc
A0A8C6E5X8_HRK-01       ------------caggcggaacttg--tag--------------------
A0A8C6CSS1_BBC3-01      ------------gaggtggagcccaattag--------------------
A0A8C6CSS1_BBC3-02      ------------gaggtggagcccaattag--------------------
                                                                          

A0A8C6DRY6_BCL2L11      -----
A0A8C6DRY6_BCL2L11      -----
A0A8C6DRY6_BCL2L11      -----
A0A8C6ECQ4_PMAIP1-      -----
A0A8C6CNS6_PMAIP1-      -----
A0A8C6D4Q6_PMAIP1-      -----
A0A8C6FY79_PMAIP1-      -----
A0A8C6CWP8_BMF-01       -----
A0A8C6FXQ6_BAD-01       agtga
A0A8C6E5X8_HRK-01       -----
A0A8C6CSS1_BBC3-01      -----
A0A8C6CSS1_BBC3-02      -----
                             

© 1998-2022Legal notice