Dataset for CDS BBC3 of organism Microcebus murinus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8B7G497_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Microcebus murinus GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cggccgcctggtgccctcggctgtgtcctgcggcctctgcgagcccggcctgcccgctgcccccgccgcccccgccctgc
tccccgccgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctctcgctggcagagcagcacctggagtcgcc
cgtccccagcgccccgggggccctggcgggcggtcccacccaggcggccccgggagtgcgtggggaggaggagcagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcag
cagagacaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctgcccctacccaggggccacagagc
ccctgagatggagcccaattag
>gnl|bcl2dbcds|A0A8B7G497_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Microcebus murinus GN=BBC3 (length=396 residues).
atgaaatttggtgtggggtctgcccgggcatgtccgtgccaggcgcccagggcttccttctcgcggtgtgtcccgggcca
tattcgcggtcctcagccctcgctctcgctggcagagcagcacctggagtcgcccgtccccagcgccccgggggccctgg
cgggcggtcccacccaggcggccccgggagtgcgtggggaggaggagcagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagagacaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgcccctacccaggggccacagagcccctgagatggagcccaattag
>gnl|bcl2dbcds|A0A8B7G497_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Microcebus murinus GN=BBC3 (length=783 residues).
atgaaatttggtgtggggtctgcccgggcatgtccgtgccaggcgcccagggcttccttctcgcggtgtgtcccgggcca
tattcgcggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgc
gacggcccgcgccccttcccgctcggccgcctggtgccctcggctgtgtcctgcggcctctgcgagcccggcctgcccgc
tgcccccgccgcccccgccctgctccccgccgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctgg
ggggcccccgctggcctgggggtccccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctctcgctg
gcagagcagcacctggagtcgcccgtccccagcgccccgggggccctggcgggcggtcccacccaggcggccccgggagt
gcgtggggaggaggagcagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacg
agcggcggagacaagaggagcagcagagacaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctg
cccctacccaggggccacagagccccgatggagcccaattaggtgcctgcacccgcccggtggacgtcggagacttgggg
ggcaggaccctctcacctcctgacaccctggccagcacgggggactctttctgcaccatgtag
© 1998-2022Legal notice