Dataset for CDS BBC3 of organism Microcebus murinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B7G497_BBC3-02      atgaaatttggtgtggggtct-----------------------------
A0A8B7G497_BBC3-01      --------------------------------------------------
A0A8B7G497_BBC3-03      atgaaatttggtgtggggtctgcccgggcatgtccgtgccaggcgcccag
                                                                          

A0A8B7G497_BBC3-02      --------------------------------------------------
A0A8B7G497_BBC3-01      --------------------------------------------------
A0A8B7G497_BBC3-03      ggcttccttctcgcggtgtgtcccgggccatattcgcggccccagggagc
                                                                          

A0A8B7G497_BBC3-02      ------gcccgggcatgtccg---------tgccaggcgccc----aggg
A0A8B7G497_BBC3-01      ---atggcccgcgcacgccaggagggcagctccccggagcccgtagaggg
A0A8B7G497_BBC3-03      gccatggcccgcgcacgccaggagggcagctccccggagcccgtagaggg
                              ***** *** * * *         * ** ** ****    ****

A0A8B7G497_BBC3-02      ctt--------------------ccttctcgc------------------
A0A8B7G497_BBC3-01      cctggcccgcgacggcccgcgccccttcccgctcggccgcctggtgccct
A0A8B7G497_BBC3-03      cctggcccgcgacggcccgcgccccttcccgctcggccgcctggtgccct
                        * *                    ***** ***                  

A0A8B7G497_BBC3-02      --ggtgtgtcccgggccatattcg--------------------------
A0A8B7G497_BBC3-01      cggctgtgtcctgcggcctctgcgagcccggcctgcccgctgcccccgcc
A0A8B7G497_BBC3-03      cggctgtgtcctgcggcctctgcgagcccggcctgcccgctgcccccgcc
                          * ******* * * * * * **                          

A0A8B7G497_BBC3-02      --------------------------------------------------
A0A8B7G497_BBC3-01      gcccccgccctgctccccgccgcctacctctgcgcccccaccgccccgcc
A0A8B7G497_BBC3-03      gcccccgccctgctccccgccgcctacctctgcgcccccaccgccccgcc
                                                                          

A0A8B7G497_BBC3-02      --------------------------------------------------
A0A8B7G497_BBC3-01      cgccgtcaccgccgccctggggggcccccgctggcctgggggtccccgca
A0A8B7G497_BBC3-03      cgccgtcaccgccgccctggggggcccccgctggcctgggggtccccgca
                                                                          

A0A8B7G497_BBC3-02      -------------------------cggtcctcagccctcgctctcgctg
A0A8B7G497_BBC3-01      gccggccccgaggcccgcgcccggacggtcctcagccctcgctctcgctg
A0A8B7G497_BBC3-03      gccggccccgaggcccgcgcccggacggtcctcagccctcgctctcgctg
                                                 *************************

A0A8B7G497_BBC3-02      gcagagcagcacctggagtcgcccgtccccagcgccccgggggccctggc
A0A8B7G497_BBC3-01      gcagagcagcacctggagtcgcccgtccccagcgccccgggggccctggc
A0A8B7G497_BBC3-03      gcagagcagcacctggagtcgcccgtccccagcgccccgggggccctggc
                        **************************************************

A0A8B7G497_BBC3-02      gggcggtcccacccaggcggccccgggagtgcgtggggaggaggagcagt
A0A8B7G497_BBC3-01      gggcggtcccacccaggcggccccgggagtgcgtggggaggaggagcagt
A0A8B7G497_BBC3-03      gggcggtcccacccaggcggccccgggagtgcgtggggaggaggagcagt
                        **************************************************

A0A8B7G497_BBC3-02      gggcccgggagatcggggcccagctgcggcggatggcggacgacctcaac
A0A8B7G497_BBC3-01      gggcccgggagatcggggcccagctgcggcggatggcggacgacctcaac
A0A8B7G497_BBC3-03      gggcccgggagatcggggcccagctgcggcggatggcggacgacctcaac
                        **************************************************

A0A8B7G497_BBC3-02      gcgcagtacgagcggcggagacaagaggagcagcagagacaccgcccctc
A0A8B7G497_BBC3-01      gcgcagtacgagcggcggagacaagaggagcagcagagacaccgcccctc
A0A8B7G497_BBC3-03      gcgcagtacgagcggcggagacaagaggagcagcagagacaccgcccctc
                        **************************************************

A0A8B7G497_BBC3-02      gccctggagggtcctgtacaatctcatcatgggactcctgcccctaccca
A0A8B7G497_BBC3-01      gccctggagggtcctgtacaatctcatcatgggactcctgcccctaccca
A0A8B7G497_BBC3-03      gccctggagggtcctgtacaatctcatcatgggactcctgcccctaccca
                        **************************************************

A0A8B7G497_BBC3-02      ggggccacagagcccctgagatggagcccaattag---------------
A0A8B7G497_BBC3-01      ggggccacagagcccctgagatggagcccaattag---------------
A0A8B7G497_BBC3-03      ggggccacagagcccc---gatggagcccaattaggtgcctgcacccgcc
                        ****************   ****************               

A0A8B7G497_BBC3-02      --------------------------------------------------
A0A8B7G497_BBC3-01      --------------------------------------------------
A0A8B7G497_BBC3-03      cggtggacgtcggagacttggggggcaggaccctctcacctcctgacacc
                                                                          

A0A8B7G497_BBC3-02      ------------------------------------
A0A8B7G497_BBC3-01      ------------------------------------
A0A8B7G497_BBC3-03      ctggccagcacgggggactctttctgcaccatgtag
                                                            

© 1998-2022Legal notice