Dataset for CDS BMF of organism Meleagris gallopavo

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|G1NHG8_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Meleagris gallopavo GN=BMF (length=546 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccaagccccggagactcttctatgggaatgctggttaccgcttacatgtccccccagttggctt
tgcattggatccaaatctccaagaagagcctcaggaaggtcagcgggaggcgcgtactgaggtgcagattgcacggaagt
tgcagtgcattgcagaccagttccaccggctccacatacagcggcatcagcagaacagaaatcaagtgtggtggcagctt
tttctctttctacacaacttggccttaaatgtggaggcgaacaggaaccgcactgggcagaggtga
>gnl|bcl2dbcds|G1NHG8_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Meleagris gallopavo GN=BMF (length=357 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcagggaatgctggttaccgcttacatgtccccccagttggctttgcattggatccaaatctccaagaagagc
ctcaggaaggtcagcgggaggcgcgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccgg
ctccacatacagcggcatcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaa
tgtggaggcgaacaggaaccgcactgggcagaggtga
© 1998-2022Legal notice