Dataset for CDS BMF of organism Meleagris gallopavo

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1NHG8_BMF-01      atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgac
G1NHG8_BMF-02      atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgac
                   ************************************************************

G1NHG8_BMF-01      gtgtttcactctgatgactttggacttgcaggtcagcctggtgagatgactgcaactggc
G1NHG8_BMF-02      gtgtttcactctgatgactttggacttgca------------------------------
                   ******************************                              

G1NHG8_BMF-01      attttcacacagaaccagtcctacagctgccttctggggaggtttcaactatttcccctc
G1NHG8_BMF-02      ------------------------------------------------------------
                                                                               

G1NHG8_BMF-01      acacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
G1NHG8_BMF-02      ------------------------------------------------------------
                                                                               

G1NHG8_BMF-01      ctcagcccgtcctcttccaagccccggagactcttctatgggaatgctggttaccgctta
G1NHG8_BMF-02      ---------------------------------------gggaatgctggttaccgctta
                                                          *********************

G1NHG8_BMF-01      catgtccccccagttggctttgcattggatccaaatctccaagaagagcctcaggaaggt
G1NHG8_BMF-02      catgtccccccagttggctttgcattggatccaaatctccaagaagagcctcaggaaggt
                   ************************************************************

G1NHG8_BMF-01      cagcgggaggcgcgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccag
G1NHG8_BMF-02      cagcgggaggcgcgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccag
                   ************************************************************

G1NHG8_BMF-01      ttccaccggctccacatacagcggcatcagcagaacagaaatcaagtgtggtggcagctt
G1NHG8_BMF-02      ttccaccggctccacatacagcggcatcagcagaacagaaatcaagtgtggtggcagctt
                   ************************************************************

G1NHG8_BMF-01      tttctctttctacacaacttggccttaaatgtggaggcgaacaggaaccgcactgggcag
G1NHG8_BMF-02      tttctctttctacacaacttggccttaaatgtggaggcgaacaggaaccgcactgggcag
                   ************************************************************

G1NHG8_BMF-01      aggtga
G1NHG8_BMF-02      aggtga
                   ******

© 1998-2021Legal notice