Dataset for CDS classical BH3-containing proteins of organism Macaca mulatta

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|A0A1D5QBW1_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca mulatta GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagc
acagcgttatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgcaccctcccagtga
>gnl|bcl2dbcds|A0A5F7ZML1_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Macaca mulatta GN=BMF (length=591 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaacagaacaggaacggggcgggccctaggcccctgac
ctggaatggggctgttgtcaaaccctgttga
>gnl|bcl2dbcds|A0A5F7ZML1_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Macaca mulatta GN=BMF (length=555 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaacagaacaggaacggggcgggccctaggtga
>gnl|bcl2dbcds|A0A5F7ZML1_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Macaca mulatta GN=BMF (length=555 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaacagaacaggaacggggcgggccctaggtga
>gnl|bcl2dbcds|A0A5F8ATY0_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Macaca mulatta GN=PMAIP1 (length=162 residues).
atgcccagcaaaaatgagaaaaccaacctccagcctcagcccaccaatcaacagatggaattgcaaattcagtttgcaaa
gaggaaaagagcgtttgggggaagattaaatagaagagacaagagtcttgctctgtcacccaggctggagtgcagtggcc
cg
>gnl|bcl2dbcds|F6SUD3_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Macaca mulatta GN=BIK (length=483 residues).
atgtctggagtaagacccatctccagagacaccttgatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtcactgaccctgaagaggacctggaccctatggaggacttcaatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggacgagatggatgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctgggtctggctttcatctacgaccagatggacgacatcagggatgttcttagaagttt
catggatggtttcaccacccttagggagaacataatgaggttctggagatccccgaatcccaggtcctgggtgtcccgtg
aacaggtgctgctggtgctgctgctgctgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctcaag
tga
>gnl|bcl2dbcds|F7HHA1_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=699 residues).
atgttcccggcggctgcggccggggcagcgcgggccagaggcgcggcgtgcggagccctcggctgcccggcggagtgcgg
cggcgggctggcgggtaggcgcgggctgtgcgctgcgccgggtactctgaacccaagtccagagctttgtttcctgcgct
gccttcgtggtgacggtcagggggcgccgggtcggcgaagagcgcgggccagacgccccggggcccgggcgcgggcccgg
acgctacgctctgaagggaaggcgcggacaaaaaaagaccaaatggcaaagcaaccttctgatgtaagttctgagtgtga
ccgagaaggtagacaattgcagcctgcggagaggcctccccagctcagacctggggcccctacctccctacagacagagc
cacaagacaggagcccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccac
tatctcagtgcaatggcttccaggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcg
gcgaatcggagacgagtttaacgcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccac
aaatggttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|F7HHA1_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=879 residues).
atgttcccggcggctgcggccggggcagcgcgggccagaggcgcggcgtgcggagccctcggctgcccggcggagtgcgg
cggcgggctggcgggtaggcgcgggctgtgcgctgcgccgggtactctgaacccaagtccagagctttgtttcctgcgct
gccttcgtggtgacggtcagggggcgccgggtcggcgaagagcgcgggccagacgccccggggcccgggcgcgggcccgg
acgctacgctctgaagggaaggcgcggacaaaaaaagaccaaatggcaaagcaaccttctgatgtaagttctgagtgtga
ccgagaaggtagacaattgcagcctgcggagaggcctccccagctcagacctggggcccctacctccctacagacagagc
cacaaggtaatcccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctcagggcccgctggcccca
ccggccagccctggcccttttgctaccagatccccgcttttcatctttatgagaagatcctccctgctgtctcgatcctc
cagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctc
cttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctgcagatatgcgcccggagata
cggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggtatttttgaataattacca
agcagccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|F7HHA1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgtt
gcgttacattgtccgcctggtgtggagaatgcattga
© 1998-2020Legal notice