Dataset for CDS classical BH3-containing proteins of organism Macaca mulatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6SUD3_BIK-01           atg--------tctggagtaagacccatctcc------------------
A0A5F7ZML1_BMF-01       atggagcc-atctcggtgtgtgg---------------------------
A0A5F7ZML1_BMF-02       atggagcc-atctcggtgtgtgg---------------------------
A0A5F7ZML1_BMF-03       atggagcc-atctcggtgtgtgg---------------------------
A0A5F8ATY0_PMAIP1-      atg-----------------------------------------------
A0A1D5QBW1_BAD-01       atgttccagatcccagagtttga---------------------------
F7HHA1_BCL2L11-03       atgttcccggcggctgcggccggggcagcgcgggccagaggcgcggcgtg
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       atgttcccggcggctgcggccggggcagcgcgggccagaggcgcggcgtg
                                                                          

F6SUD3_BIK-01           ------------------------------------agagacaccttgat
A0A5F7ZML1_BMF-01       ------------------------------------aggagctggaggat
A0A5F7ZML1_BMF-02       ------------------------------------aggagctggaggat
A0A5F7ZML1_BMF-03       ------------------------------------aggagctggaggat
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A1D5QBW1_BAD-01       -------------------------------gcctagtgagcaggaagac
F7HHA1_BCL2L11-03       cggagccctcggctgcccggcggagtgcggcggcgggctggcgggtaggc
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       cggagccctcggctgcccggcggagtgcggcggcgggctggcgggtaggc
                                                                          

F6SUD3_BIK-01           ggagaccctc--ctgtatgagcagctcctggaacccctaaccatggaggt
A0A5F7ZML1_BMF-01       gatgtgttccagccggaggacggggagccgggggcccaacccgggagctc
A0A5F7ZML1_BMF-02       gatgtgttccagccggaggacggggagccgggggcccaacccgggagctc
A0A5F7ZML1_BMF-03       gatgtgttccagccggaggacggggagccgggggcccaacccgggagctc
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A1D5QBW1_BAD-01       tccagct-----ctgcag--agaggggcctgggccccagccc--------
F7HHA1_BCL2L11-03       gcgggctgtgcgctgcgc--cgggtactctgaacccaagtccagagcttt
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       gcgggctgtgcgctgcgc--cgggtactctgaacccaagtccagagcttt
                                                                          

F6SUD3_BIK-01           tcttggtgt-----------------------------------------
A0A5F7ZML1_BMF-01       gctctctgc---------------------------cgatctgtttgccc
A0A5F7ZML1_BMF-02       gctctctgc---------------------------cgatctgtttgccc
A0A5F7ZML1_BMF-03       gctctctgc---------------------------cgatctgtttgccc
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A1D5QBW1_BAD-01       --------------------------------------------------
F7HHA1_BCL2L11-03       gtttcctgcgctgccttcgtggtgacggtcagggggcgccgggtcggcga
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       gtttcctgcgctgccttcgtggtgacggtcagggggcgccgggtcggcga
                                                                          

F6SUD3_BIK-01           -----------cactgaccctgaag-------------------------
A0A5F7ZML1_BMF-01       agagcctacttgactgccccctcagccgacttcagctcttccctctcacc
A0A5F7ZML1_BMF-02       agagcctacttgactgccccctcagccgacttcagctcttccctctcacc
A0A5F7ZML1_BMF-03       agagcctacttgactgccccctcagccgacttcagctcttccctctcacc
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A1D5QBW1_BAD-01       ----cgcgggggacaggccctcagactccggcaagcatc-----------
F7HHA1_BCL2L11-03       agagcgcgggccagacgccccggggcccgggcgcgggcccggacgctacg
F7HHA1_BCL2L11-01       --------------------------------------------------
F7HHA1_BCL2L11-02       agagcgcgggccagacgccccggggcccgggcgcgggcccggacgctacg
                                                                          

F6SUD3_BIK-01           ----------------------------------------aggacctgga
A0A5F7ZML1_BMF-01       c---------------------------------actgctgtggccctgg
A0A5F7ZML1_BMF-02       c---------------------------------actgctgtggccctgg
A0A5F7ZML1_BMF-03       c---------------------------------actgctgtggccctgg
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A1D5QBW1_BAD-01       ----------------------------------atcgccaggccccagg
F7HHA1_BCL2L11-03       ctctgaagggaaggcgcggacaaaaaaagaccaaatggcaaagc----aa
F7HHA1_BCL2L11-01       ----------------------------------atggcaaagc----aa
F7HHA1_BCL2L11-02       ctctgaagggaaggcgcggacaaaaaaagaccaaatggcaaagc----aa
                                                                          

F6SUD3_BIK-01           ccctatggaggacttcaatcctttggagtgtatggaggacagtgacatgt
A0A5F7ZML1_BMF-01       ccttcg----------acccaccagccaggaagacaaggcca--------
A0A5F7ZML1_BMF-02       ccttcg----------acccaccagccaggaagacaaggcca--------
A0A5F7ZML1_BMF-03       ccttcg----------acccaccagccaggaagacaaggcca--------
A0A5F8ATY0_PMAIP1-      --------------------cccagcaaaaatgagaa---aa--------
A0A1D5QBW1_BAD-01       cctcctgtgggacgccagtcaccagcag----gagcagccaa--------
F7HHA1_BCL2L11-03       ccttct----gatgtaagttctgagtgtgaccgagaaggtag--------
F7HHA1_BCL2L11-01       ccttct----gatgtaagttctgagtgtgaccgagaaggtag--------
F7HHA1_BCL2L11-02       ccttct----gatgtaagttctgagtgtgaccgagaaggtag--------
                                                *                         

F6SUD3_BIK-01           tggccctgcggctggcctgcatcggggacgagatggatgtgagcctcagg
A0A5F7ZML1_BMF-01       ----cc--------------------------------cagaccctcgg-
A0A5F7ZML1_BMF-02       ----cc--------------------------------cagaccctcgg-
A0A5F7ZML1_BMF-03       ----cc--------------------------------cagaccctcgg-
A0A5F8ATY0_PMAIP1-      ----ccaac-----------------------------------------
A0A1D5QBW1_BAD-01       ----ccagcagc-agccatcatggaggc-------gctggggctgtggag
F7HHA1_BCL2L11-03       ----acaattgc-agcctgcggagaggcctccccagctcagacc-tgggg
F7HHA1_BCL2L11-01       ----acaattgc-agcctgcggagaggcctccccagctcagacc-tgggg
F7HHA1_BCL2L11-02       ----acaattgc-agcctgcggagaggcctccccagctcagacc-tgggg
                             *                                            

F6SUD3_BIK-01           gccccgcgcct---------------------------------------
A0A5F7ZML1_BMF-01       -cccagcctcccc-cagccaaggtgtcatgctgccctgtggggtaactga
A0A5F7ZML1_BMF-02       -cccagcctcccc-cagccaaggtgtcatgctgccctgtggggtaactga
A0A5F7ZML1_BMF-03       -cccagcctcccc-cagccaaggtgtcatgctgccctgtggggtaactga
A0A5F8ATY0_PMAIP1-      ctccagcctc----------------------------------------
A0A1D5QBW1_BAD-01       acccggagtcgccacagctcctaccccgcgggga---cggaggaggacga
F7HHA1_BCL2L11-03       cccctacctccctacagacagagccaca----------------------
F7HHA1_BCL2L11-01       cccctacctccctacagacagagccacaaggtaatcccgaaggcaatcac
F7HHA1_BCL2L11-02       cccctacctccctacagacagagccacaaggtaatcccgaaggcaatcac
                          **     *                                        

F6SUD3_BIK-01           --------------------------------------------------
A0A5F7ZML1_BMF-01       gga-----------------------------------------------
A0A5F7ZML1_BMF-02       gga-----------------------------------------------
A0A5F7ZML1_BMF-03       gga-----------------------------------------------
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A1D5QBW1_BAD-01       agggatggagg---------------------------------------
F7HHA1_BCL2L11-03       --------------------------------------------------
F7HHA1_BCL2L11-01       ggaggtgaaggggacagctgcccccacggcagccctcagggcccgctggc
F7HHA1_BCL2L11-02       ggaggtgaaggggacagctgcccccacggcagccctcagggcccgctggc
                                                                          

F6SUD3_BIK-01           --------------------------------------------------
A0A5F7ZML1_BMF-01       --------------------------------------------------
A0A5F7ZML1_BMF-02       --------------------------------------------------
A0A5F7ZML1_BMF-03       --------------------------------------------------
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A1D5QBW1_BAD-01       --------------------------------------------------
F7HHA1_BCL2L11-03       --------------------------------------------------
F7HHA1_BCL2L11-01       cccaccggccagccctggcccttttgctaccagatccccgcttttcatct
F7HHA1_BCL2L11-02       cccaccggccagccctggcccttttgctaccagatccccgcttttcatct
                                                                          

F6SUD3_BIK-01           --------------------------------------------------
A0A5F7ZML1_BMF-01       --------------------------------------------------
A0A5F7ZML1_BMF-02       --------------------------------------------------
A0A5F7ZML1_BMF-03       --------------------------------------------------
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A1D5QBW1_BAD-01       --------------------------------------------------
F7HHA1_BCL2L11-03       --------------------------------------------------
F7HHA1_BCL2L11-01       ttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctct
F7HHA1_BCL2L11-02       ttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctct
                                                                          

F6SUD3_BIK-01           ---------------ggcccagctctctgaggt-----------------
A0A5F7ZML1_BMF-01       ---------------accccagcgactcttttacggcaatgctggctacc
A0A5F7ZML1_BMF-02       ---------------accccagcgactcttttacggcaatgctggctacc
A0A5F7ZML1_BMF-03       ---------------accccagcgactcttttacggcaatgctggctacc
A0A5F8ATY0_PMAIP1-      ---------------agcccaccaatcaacagatggaa------------
A0A1D5QBW1_BAD-01       ------------aggagcccagcccctttcgg------------------
F7HHA1_BCL2L11-03       --------agacaggagcccagcacccatgagttgtgacaaatcaacaca
F7HHA1_BCL2L11-01       tttgacacagacaggagcccagcacccatgagttgtgacaaatcaacaca
F7HHA1_BCL2L11-02       tttgacacagacaggagcccagcacccatgagttgtgacaaatcaacaca
                                         **** *                           

F6SUD3_BIK-01           ggccatgcacagcctgggtctggctttcatctacgacc------------
A0A5F7ZML1_BMF-01       ggcttc---ctctccctgccagtttcc---cggcagtcttgcccatcggg
A0A5F7ZML1_BMF-02       ggcttc---ctctccctgccagtttcc---cggcagtcttgcccatcggg
A0A5F7ZML1_BMF-03       ggcttc---ctctccctgccagtttcc---cggcagtcttgcccatcggg
A0A5F8ATY0_PMAIP1-      ------------------------------ttgcaaat-------tcagt
A0A1D5QBW1_BAD-01       ggccgctcgcgctccgcgcc----------ccccaacc-------tctgg
F7HHA1_BCL2L11-03       aaccccaagtcctccttgccaggccttcaaccactatc-------tcagt
F7HHA1_BCL2L11-01       aaccccaagtcctccttgccaggccttcaaccactatc-------tcagt
F7HHA1_BCL2L11-02       aaccccaagtcctccttgccaggccttcaaccactatc-------tcagt
                                                         *                

F6SUD3_BIK-01           ------------------------------------agatggacgacatc
A0A5F7ZML1_BMF-01       gagcagccccccgaagggcagtggcaacat---------cgagcagaggt
A0A5F7ZML1_BMF-02       gagcagccccccgaagggcagtggcaacat---------cgagcagaggt
A0A5F7ZML1_BMF-03       gagcagccccccgaagggcagtggcaacat---------cgagcagaggt
A0A5F8ATY0_PMAIP1-      --------------------------------------------------
A0A1D5QBW1_BAD-01       gca-------------------------------------gcacagcgtt
F7HHA1_BCL2L11-03       gcaatggcttccaggaggcaggctgaacctgcagatatgcgcccggagat
F7HHA1_BCL2L11-01       gcaatggcttccaggaggcaggctgaacctgcagatatgcgcccggagat
F7HHA1_BCL2L11-02       gcaatggcttccaggaggcaggctgaacctgcagatatgcgcccggagat
                                                                          

F6SUD3_BIK-01           agggatgttcttagaagtttcatggatg--------gtttcaccaccctt
A0A5F7ZML1_BMF-01       acagattgcccgaaagcttcagtgcattgcagaccagttccac-------
A0A5F7ZML1_BMF-02       acagattgcccgaaagcttcagtgcattgcagaccagttccac-------
A0A5F7ZML1_BMF-03       acagattgcccgaaagcttcagtgcattgcagaccagttccac-------
A0A5F8ATY0_PMAIP1-      ----------------ttgcaaagaggaaaaga-gcgttt----------
A0A1D5QBW1_BAD-01       atgg-----ccgcgagctccggaggatgagtgacgagttt----------
F7HHA1_BCL2L11-03       acggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttact
F7HHA1_BCL2L11-01       acggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttact
F7HHA1_BCL2L11-02       acggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttact
                                         *     *            ***           

F6SUD3_BIK-01           agg----gagaacataatgaggttctggagatccccgaatcccaggtcct
A0A5F7ZML1_BMF-01       -------cggctccatgtgcagc----aacaccagcagaaccgaaat---
A0A5F7ZML1_BMF-02       -------cggctccatgtgcagc----aacaccagcagaaccgaaat---
A0A5F7ZML1_BMF-03       -------cggctccatgtgcagc----aacaccagcagaaccgaaat---
A0A5F8ATY0_PMAIP1-      -------gggg-------------------------------gaaga---
A0A1D5QBW1_BAD-01       -------gtggactcctttaagg----gacttcctcgc--ccgaagagcg
F7HHA1_BCL2L11-03       atgcaaggagggtatttttgaat----aattaccaagcagccgaaga---
F7HHA1_BCL2L11-01       atgcaaggagggtatttttgaat----aattaccaagcagccgaaga---
F7HHA1_BCL2L11-02       atgcaaggagggtatttttgaat----aattaccaagcagccgaaga---
                                 *                                 *      

F6SUD3_BIK-01           gggtgtcccgtgaacaggtgctgctggtgctgctgctgctgctg------
A0A5F7ZML1_BMF-01       --------------cgcgtgtggtggcagatcctcctcttcctgcacaac
A0A5F7ZML1_BMF-02       --------------cgcgtgtggtggcagatcctcctcttcctgcacaac
A0A5F7ZML1_BMF-03       --------------cgcgtgtggtggcagatcctcctcttcctgcacaac
A0A5F8ATY0_PMAIP1-      ---------ttaaatagaagagacaa-gagtcttgct-------------
A0A1D5QBW1_BAD-01       cgggcacagcgacgcagatgcggcaa-agctccagctggacgcgagtctt
F7HHA1_BCL2L11-03       ---------ccacccacaaatggtta-tcttacgactg---ttgcgttac
F7HHA1_BCL2L11-01       ---------ccacccacaaatggtta-tcttacgactg---ttgcgttac
F7HHA1_BCL2L11-02       ---------ccacccacaaatggtta-tcttacgactg---ttgcgttac
                                                      *    **             

F6SUD3_BIK-01           ---gcactgctgctggcgctgctcag-cgggggcctgcacctgctgctca
A0A5F7ZML1_BMF-01       cttgctttgaatggagaacagaacaggaacggggcgggccctaggcccct
A0A5F7ZML1_BMF-02       cttgctttgaatggagaacagaacaggaacggggcgggccctagg-----
A0A5F7ZML1_BMF-03       cttgctttgaatggagaacagaacaggaacggggcgggccctagg-----
A0A5F8ATY0_PMAIP1-      -ctgtc--------------acccaggctggag--------------tgc
A0A1D5QBW1_BAD-01       ccagtcctggtgggatcggaacttgggcaggggaagctccgcaccctccc
F7HHA1_BCL2L11-03       attgtcc-------------gcctggtgtggagaa------------tgc
F7HHA1_BCL2L11-01       attgtcc-------------gcctggtgtggagaa------------tgc
F7HHA1_BCL2L11-02       attgtcc-------------gcctggtgtggagaa------------tgc
                           *                     *    * *                 

F6SUD3_BIK-01           ag-----------------------------tga----
A0A5F7ZML1_BMF-01       gacctggaatggggctgttgtcaaaccctgttga----
A0A5F7ZML1_BMF-02       -------------------------------tga----
A0A5F7ZML1_BMF-03       -------------------------------tga----
A0A5F8ATY0_PMAIP1-      ag-----------------------------tggcccg
A0A1D5QBW1_BAD-01       ag-----------------------------tga----
F7HHA1_BCL2L11-03       at-----------------------------tga----
F7HHA1_BCL2L11-01       at-----------------------------tga----
F7HHA1_BCL2L11-02       at-----------------------------tga----
                                                       **     

© 1998-2022Legal notice