Dataset for CDS classical BH3-containing proteins of organism Macaca fascicularis

[Download (right click)] [Alignment] [Repertoires]

16 sequence(s)

>gnl|bcl2dbcds|A0A2K5V8L0_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Macaca fascicularis GN=BBC3 (length=393 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggcttcttctgcgacgtgggtcccctgcca
gatttgtggtcctcagccctcgctcttgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctgg
cgggcggtcccacccaggcggccccgggagtccgcgaggaggaacagtgggcccgggagatcggggcccagctgcggcgg
atggcggacgacctcaacgcgcaatacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggagggt
cctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgaaatggagcccaattag
>gnl|bcl2dbcds|A0A2K5VCA1_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca fascicularis GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
ggggaacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagc
acagcgttatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgcaccctcccagtga
>gnl|bcl2dbcds|A0A2K5VPX2_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Macaca fascicularis GN=PMAIP1 (length=405 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccaacgcgggctcaggcaggaccggggactgcagggacggc
agggacggcgagggaccaggccggatttgggattgggatgcagctgcattacaccagaggcaaaaagctcgtctcctcct
ccccacttgtccttccgcggggccacgaggaacaagtgcaagtagctcgaagtcgagtgtgctactcaactcaggagatt
tggagacaaactgaacttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaacctgactgcatcaaa
aacttgcataaggggactccaaaagagactttttctcaggaggtgcacacttcatcaatttgaagaaagattgcattgta
attgg
>gnl|bcl2dbcds|A0A2K5VW94_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Macaca fascicularis GN=BIK (length=510 residues).
atgctgtctttttgccccaaaggagaaatgtctggagtaagacccatctccagagacaccttgatggagaccctcctgta
tgagcagctcctggaacccctaaccatggaggttcttggtgtcactgaccctgaagaggacctggaccctatggaggact
tcgatcctttggagtgtatggaggacagtgacatgttggccctgcggctggcctgcatcggggacgagatggatgtgagc
ctcagggccccgcgcctggcccagctctctgaggtggccatgcacagcctgggtctggctttcatctacgaccagatgga
cgacatcagggatgttcttagaagtttcatggatggtttcaccacccttagggagaacataatgaggttctggagatccc
cgaatcccaggtcctgggtgtcccgtgaacaggtgctgctggtgctgctgctgctgctggcactgctgctggcgctgctc
agcgggggcctgcacctgctgctcaagtga
>gnl|bcl2dbcds|A0A2K5X1Y3_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaattggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgtt
gcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5X1Y3_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaattggagacgagtttaac
gcttactatgcaaggaggatgtcgcttccacctgattaa
>gnl|bcl2dbcds|A0A2K5X1Y3_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=258 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagcttccaggaggcaggctgaacctgcagatatgcgcc
cggagatacggatcgcccaagagttgcggcgaattggagacgagtttaacgcttactatgcaaggaggttggcagaactc
ctggcatcctccacctga
>gnl|bcl2dbcds|A0A2K5X1Y3_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=294 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgaggccactggatcctccctcgga
attgcccttcatagggaagttcagtggccgctcgagtggttagcatcaagctaa
>gnl|bcl2dbcds|A0A2K5X1Y3_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatcctagaggatataggtgat
agttcattgtggtttggatttatatttactggcttagatttgtatggccaccaccacagtcaagatacagaacaactcaa
ccacaaggatttctcatga
>gnl|bcl2dbcds|A0A2K5X1Y3_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaattggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2K5X1Y3_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=879 residues).
atgttcccggcggctgcggccggggcagcgcgggccagaggcgcggcgtgcggaaccctcggctgcccggcggagtgcgg
cggcgggctggcgggaaggcgcgggctgtgcgctgcgccgggtactctgaacccaagtccagagctttgtttcctgcgct
gccttcgtggtgacggtcagggggcgccgggtcggcgaagagcgcgggccagacgccccggggcccgggcgcgggcccgg
acgctacgctctgaagggaaggcgcggacaaaaaaagaccaaatggcaaagcaaccttctgatgtaagttctgagtgtga
ccgagaaggtagacaattgcagcctgcggagaggcctccccagctcagacctggggcccctacctccctacagacagagc
cacaaggtaatcccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctcagggcccgctggcccca
ccggccagccctggcccttttgctaccagatccccgcttttcatctttatgagaagatcctccctgctgtctcgatcctc
cagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctc
cttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctgcagatatgcgcccggagata
cggatcgcccaagagttgcggcgaattggagacgagtttaacgcttactatgcaaggagggtatttttgaataattacca
agcagccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5X1Y3_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=699 residues).
atgttcccggcggctgcggccggggcagcgcgggccagaggcgcggcgtgcggaaccctcggctgcccggcggagtgcgg
cggcgggctggcgggaaggcgcgggctgtgcgctgcgccgggtactctgaacccaagtccagagctttgtttcctgcgct
gccttcgtggtgacggtcagggggcgccgggtcggcgaagagcgcgggccagacgccccggggcccgggcgcgggcccgg
acgctacgctctgaagggaaggcgcggacaaaaaaagaccaaatggcaaagcaaccttctgatgtaagttctgagtgtga
ccgagaaggtagacaattgcagcctgcggagaggcctccccagctcagacctggggcccctacctccctacagacagagc
cacaagacaggagcccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccac
tatctcagtgcaatggcttccaggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcg
gcgaattggagacgagtttaacgcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccac
aaatggttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A7N9CRT3_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Macaca fascicularis GN=BMF (length=555 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccggggtcccaacccgg
gagctctctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccctaggtga
>gnl|bcl2dbcds|A0A7N9CRT3_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Macaca fascicularis GN=BMF (length=546 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccggggtcccaacccgg
gagctctctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaaaaccgaaatcgcgtgtggtggcagatc
ctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccctaggtga
>gnl|bcl2dbcds|A0A7N9CRT3_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Macaca fascicularis GN=BMF (length=591 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccggggtcccaacccgg
gagctctctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccctaggcccctgac
ctggaatggggctgttgtcaaaccctgttga
>gnl|bcl2dbcds|Q2PG01_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca fascicularis GN=BAD (length=249 residues).
atggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccg
cgagctccggaggatgagtgacgagtttgtggactcctttaaggggcttcctcgcccgaagagcgcgggcacagcgacgc
agatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgcaccc
tcccagtga
© 1998-2022Legal notice